\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215271044:

Variant ID: vg1215271044 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15271044
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAAGGTCTAAAGTAACGACTAATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGAACCCAAAGATGTGTCACATACATTAACTGAAGAATC[A/G]
TGGATTAACGCCATGCATGAAGAACTTGAAAATTTTGAGAGAAACAAAGTTTGGACTTTAGTTGAACCACCTTCTGGACATAATATTATTGGAACCAAGT

Reverse complement sequence

ACTTGGTTCCAATAATATTATGTCCAGAAGGTGGTTCAACTAAAGTCCAAACTTTGTTTCTCTCAAAATTTTCAAGTTCTTCATGCATGGCGTTAATCCA[T/C]
GATTCTTCAGTTAATGTATGTGACACATCTTTGGGTTCAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATTAGTCGTTACTTTAGACCTTGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.80% 28.20% 27.87% 10.05% NA
All Indica  2759 42.60% 7.00% 37.44% 12.98% NA
All Japonica  1512 21.60% 68.10% 3.90% 6.42% NA
Aus  269 9.30% 21.20% 64.31% 5.20% NA
Indica I  595 37.00% 5.70% 54.29% 3.03% NA
Indica II  465 68.40% 6.00% 8.82% 16.77% NA
Indica III  913 29.60% 6.00% 45.89% 18.51% NA
Indica Intermediate  786 46.60% 9.80% 31.81% 11.83% NA
Temperate Japonica  767 5.20% 91.50% 1.56% 1.69% NA
Tropical Japonica  504 45.60% 34.70% 5.75% 13.89% NA
Japonica Intermediate  241 23.20% 63.50% 7.47% 5.81% NA
VI/Aromatic  96 52.10% 12.50% 35.42% 0.00% NA
Intermediate  90 26.70% 46.70% 20.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215271044 A -> DEL N N silent_mutation Average:20.492; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1215271044 A -> G LOC_Os12g26204.1 downstream_gene_variant ; 3853.0bp to feature; MODIFIER silent_mutation Average:20.492; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg1215271044 A -> G LOC_Os12g26190.1 intron_variant ; MODIFIER silent_mutation Average:20.492; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215271044 7.31E-07 NA mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 7.90E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 2.47E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 1.26E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 9.60E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 1.37E-06 7.05E-15 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 5.82E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 3.77E-13 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 1.38E-11 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 7.96E-06 NA mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 9.51E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 9.71E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 5.61E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 9.34E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 4.80E-06 NA mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 6.56E-07 8.31E-13 mr1490 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 5.09E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 9.35E-07 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 5.35E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 6.48E-07 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 1.28E-16 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 9.76E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 1.29E-07 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 3.28E-06 5.53E-16 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 1.65E-07 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 1.50E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 3.31E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 2.13E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 5.48E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 2.48E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 1.54E-06 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 4.25E-10 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215271044 NA 2.94E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251