\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215251809:

Variant ID: vg1215251809 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15251809
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTATGTATTAAGTTTGTAGTTAATCAAACTCAAAACAACTTATAATCCATTTGAATCCAAGTGCTTTACATTTTTTAAAAATAGTCTATGCCAATTA[C/G]
AAATCACTTTATTATTTTCAAATTTTCAGAATTACATTAATAAACTACTAACTCTTCAATGTCTATTAGTTTCAACATGATATTTATTAATTCTGAAATT

Reverse complement sequence

AATTTCAGAATTAATAAATATCATGTTGAAACTAATAGACATTGAAGAGTTAGTAGTTTATTAATGTAATTCTGAAAATTTGAAAATAATAAAGTGATTT[G/C]
TAATTGGCATAGACTATTTTTAAAAAATGTAAAGCACTTGGATTCAAATGGATTATAAGTTGTTTTGAGTTTGATTAACTACAAACTTAATACATAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.40% 1.30% 3.11% 49.13% NA
All Indica  2759 30.20% 0.00% 2.32% 67.45% NA
All Japonica  1512 80.10% 2.20% 3.44% 14.29% NA
Aus  269 16.70% 0.40% 5.20% 77.70% NA
Indica I  595 10.30% 0.00% 0.84% 88.91% NA
Indica II  465 59.40% 0.00% 1.29% 39.35% NA
Indica III  913 23.80% 0.00% 2.74% 73.49% NA
Indica Intermediate  786 35.60% 0.00% 3.56% 60.81% NA
Temperate Japonica  767 94.70% 0.10% 1.17% 4.04% NA
Tropical Japonica  504 61.70% 5.40% 4.56% 28.37% NA
Japonica Intermediate  241 72.20% 2.10% 8.30% 17.43% NA
VI/Aromatic  96 52.10% 21.90% 13.54% 12.50% NA
Intermediate  90 61.10% 7.80% 4.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215251809 C -> DEL N N silent_mutation Average:20.059; most accessible tissue: Callus, score: 55.104 N N N N
vg1215251809 C -> G LOC_Os12g26170.1 downstream_gene_variant ; 492.0bp to feature; MODIFIER silent_mutation Average:20.059; most accessible tissue: Callus, score: 55.104 N N N N
vg1215251809 C -> G LOC_Os12g26180.1 downstream_gene_variant ; 1310.0bp to feature; MODIFIER silent_mutation Average:20.059; most accessible tissue: Callus, score: 55.104 N N N N
vg1215251809 C -> G LOC_Os12g26170-LOC_Os12g26180 intergenic_region ; MODIFIER silent_mutation Average:20.059; most accessible tissue: Callus, score: 55.104 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215251809 NA 1.12E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 6.85E-06 8.35E-14 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.00E-08 NA mr1018 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 9.49E-07 6.42E-14 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.57E-06 NA mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 1.37E-10 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 2.94E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 8.70E-07 1.87E-14 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 1.99E-13 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 6.97E-10 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 2.21E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 5.00E-07 4.99E-16 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 8.25E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 1.32E-07 1.09E-16 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.33E-06 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 4.75E-07 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 2.00E-08 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 8.39E-07 NA mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.23E-06 9.66E-13 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 4.11E-10 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 4.24E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 1.93E-08 4.04E-16 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 7.51E-06 1.12E-13 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 1.98E-07 NA mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 9.01E-08 4.98E-18 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 4.76E-06 NA mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.39E-07 1.15E-17 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 8.78E-06 NA mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 NA 3.79E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 5.83E-06 NA mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 7.19E-09 3.37E-19 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 1.64E-08 NA mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 3.71E-06 NA mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 2.65E-09 4.53E-20 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215251809 3.94E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251