\
| Variant ID: vg1215227027 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15227027 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAGGAAATATAGGTGAGCGGACTACAAGGTCTAAGGTAACGACTCATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGAACCCAAAGATGTGTC[A/G,T]
CATGCAATAACTGACGAATCGTGGATTAACGCCATGCATGAAGAACTTGAAAATTTTGAGAGAAACAAAGTTTGGACTTTAGTTGAACCACCTTCTGGAC
GTCCAGAAGGTGGTTCAACTAAAGTCCAAACTTTGTTTCTCTCAAAATTTTCAAGTTCTTCATGCATGGCGTTAATCCACGATTCGTCAGTTATTGCATG[T/C,A]
GACACATCTTTGGGTTCAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATGAGTCGTTACCTTAGACCTTGTAGTCCGCTCACCTATATTTCCTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.00% | 3.00% | 11.00% | 42.02% | T: 0.04% |
| All Indica | 2759 | 37.40% | 0.20% | 10.80% | 51.58% | T: 0.07% |
| All Japonica | 1512 | 64.40% | 7.70% | 6.08% | 21.76% | NA |
| Aus | 269 | 13.40% | 0.00% | 34.20% | 52.42% | NA |
| Indica I | 595 | 12.80% | 0.00% | 13.78% | 73.45% | NA |
| Indica II | 465 | 68.60% | 0.20% | 4.73% | 26.45% | NA |
| Indica III | 913 | 31.20% | 0.10% | 11.50% | 56.96% | T: 0.22% |
| Indica Intermediate | 786 | 44.70% | 0.40% | 11.32% | 43.64% | NA |
| Temperate Japonica | 767 | 91.80% | 0.30% | 2.48% | 5.48% | NA |
| Tropical Japonica | 504 | 22.20% | 22.20% | 11.31% | 44.25% | NA |
| Japonica Intermediate | 241 | 65.60% | 1.20% | 6.64% | 26.56% | NA |
| VI/Aromatic | 96 | 1.00% | 10.40% | 21.88% | 66.67% | NA |
| Intermediate | 90 | 40.00% | 8.90% | 18.89% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215227027 | A -> DEL | LOC_Os12g26140.1 | N | frameshift_variant | Average:8.395; most accessible tissue: Callus, score: 36.525 | N | N | N | N |
| vg1215227027 | A -> G | LOC_Os12g26140.1 | synonymous_variant ; p.Ser1074Ser; LOW | synonymous_codon | Average:8.395; most accessible tissue: Callus, score: 36.525 | N | N | N | N |
| vg1215227027 | A -> T | LOC_Os12g26140.1 | synonymous_variant ; p.Ser1074Ser; LOW | synonymous_codon | Average:8.395; most accessible tissue: Callus, score: 36.525 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215227027 | NA | 9.21E-09 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 2.63E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 1.79E-06 | mr1215 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 4.75E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | 7.10E-06 | 1.95E-06 | mr1294 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | 1.66E-07 | 1.07E-10 | mr1422 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | 1.14E-07 | 7.23E-12 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 4.95E-06 | mr1835 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 9.10E-06 | mr1124_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 1.47E-09 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 1.30E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215227027 | NA | 8.63E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |