RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1215227027:

Variant ID: vg1215227027 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15227027
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGAAATATAGGTGAGCGGACTACAAGGTCTAAGGTAACGACTCATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGAACCCAAAGATGTGTC[A/G,T]
CATGCAATAACTGACGAATCGTGGATTAACGCCATGCATGAAGAACTTGAAAATTTTGAGAGAAACAAAGTTTGGACTTTAGTTGAACCACCTTCTGGAC

Reverse complement sequence

GTCCAGAAGGTGGTTCAACTAAAGTCCAAACTTTGTTTCTCTCAAAATTTTCAAGTTCTTCATGCATGGCGTTAATCCACGATTCGTCAGTTATTGCATG[T/C,A]
GACACATCTTTGGGTTCAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATGAGTCGTTACCTTAGACCTTGTAGTCCGCTCACCTATATTTCCTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.00%	3.00%	11.00%	42.02%	T: 0.04%
All Indica	2759	37.40%	0.20%	10.80%	51.58%	T: 0.07%
All Japonica	1512	64.40%	7.70%	6.08%	21.76%	NA
Aus	269	13.40%	0.00%	34.20%	52.42%	NA
Indica I	595	12.80%	0.00%	13.78%	73.45%	NA
Indica II	465	68.60%	0.20%	4.73%	26.45%	NA
Indica III	913	31.20%	0.10%	11.50%	56.96%	T: 0.22%
Indica Intermediate	786	44.70%	0.40%	11.32%	43.64%	NA
Temperate Japonica	767	91.80%	0.30%	2.48%	5.48%	NA
Tropical Japonica	504	22.20%	22.20%	11.31%	44.25%	NA
Japonica Intermediate	241	65.60%	1.20%	6.64%	26.56%	NA
VI/Aromatic	96	1.00%	10.40%	21.88%	66.67%	NA
Intermediate	90	40.00%	8.90%	18.89%	32.22%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215227027	A -> DEL	LOC_Os12g26140.1	N	frameshift_variant	Average:8.395; most accessible tissue: Callus, score: 36.525	N	N	N	N
vg1215227027	A -> G	LOC_Os12g26140.1	synonymous_variant ; p.Ser1074Ser; LOW	synonymous_codon	Average:8.395; most accessible tissue: Callus, score: 36.525	N	N	N	N
vg1215227027	A -> T	LOC_Os12g26140.1	synonymous_variant ; p.Ser1074Ser; LOW	synonymous_codon	Average:8.395; most accessible tissue: Callus, score: 36.525	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215227027	NA	9.21E-09	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	2.63E-06	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	1.79E-06	mr1215	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	4.75E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	7.10E-06	1.95E-06	mr1294	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	1.66E-07	1.07E-10	mr1422	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	1.14E-07	7.23E-12	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	4.95E-06	mr1835	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	9.10E-06	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027	NA	1.47E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 12 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1215227027:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact