\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215227027:

Variant ID: vg1215227027 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15227027
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGAAATATAGGTGAGCGGACTACAAGGTCTAAGGTAACGACTCATGATGTTTGTGCAAATTCTGCATTTGTTGCTTCTTTTGAACCCAAAGATGTGTC[A/G,T]
CATGCAATAACTGACGAATCGTGGATTAACGCCATGCATGAAGAACTTGAAAATTTTGAGAGAAACAAAGTTTGGACTTTAGTTGAACCACCTTCTGGAC

Reverse complement sequence

GTCCAGAAGGTGGTTCAACTAAAGTCCAAACTTTGTTTCTCTCAAAATTTTCAAGTTCTTCATGCATGGCGTTAATCCACGATTCGTCAGTTATTGCATG[T/C,A]
GACACATCTTTGGGTTCAAAAGAAGCAACAAATGCAGAATTTGCACAAACATCATGAGTCGTTACCTTAGACCTTGTAGTCCGCTCACCTATATTTCCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.00% 3.00% 11.00% 42.02% T: 0.04%
All Indica  2759 37.40% 0.20% 10.80% 51.58% T: 0.07%
All Japonica  1512 64.40% 7.70% 6.08% 21.76% NA
Aus  269 13.40% 0.00% 34.20% 52.42% NA
Indica I  595 12.80% 0.00% 13.78% 73.45% NA
Indica II  465 68.60% 0.20% 4.73% 26.45% NA
Indica III  913 31.20% 0.10% 11.50% 56.96% T: 0.22%
Indica Intermediate  786 44.70% 0.40% 11.32% 43.64% NA
Temperate Japonica  767 91.80% 0.30% 2.48% 5.48% NA
Tropical Japonica  504 22.20% 22.20% 11.31% 44.25% NA
Japonica Intermediate  241 65.60% 1.20% 6.64% 26.56% NA
VI/Aromatic  96 1.00% 10.40% 21.88% 66.67% NA
Intermediate  90 40.00% 8.90% 18.89% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215227027 A -> DEL LOC_Os12g26140.1 N frameshift_variant Average:8.395; most accessible tissue: Callus, score: 36.525 N N N N
vg1215227027 A -> G LOC_Os12g26140.1 synonymous_variant ; p.Ser1074Ser; LOW synonymous_codon Average:8.395; most accessible tissue: Callus, score: 36.525 N N N N
vg1215227027 A -> T LOC_Os12g26140.1 synonymous_variant ; p.Ser1074Ser; LOW synonymous_codon Average:8.395; most accessible tissue: Callus, score: 36.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215227027 NA 9.21E-09 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 2.63E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 1.79E-06 mr1215 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 4.75E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 7.10E-06 1.95E-06 mr1294 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 1.66E-07 1.07E-10 mr1422 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 1.14E-07 7.23E-12 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 4.95E-06 mr1835 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 9.10E-06 mr1124_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 1.47E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 1.30E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215227027 NA 8.63E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251