\
| Variant ID: vg1215222085 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr12 | Position: 15222085 |
| Reference Allele: C | Alternative Allele: A,CA |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACATGCTAAGTTTATCCTCCGCTGCTAAGTTGTACTCCCTCCATTTTAAAATGTTTGACACTGTTGACTTTTTAGTACGTGTTTGACCATTCGTCTTATT[C/A,CA]
AAAAAATTTAAGTAATTATTTATTCTTTTCATATCAAGTTGGAGATAGCTTGGTCTCGGAATATGATTTCTTTATTTGTTCCATGTGTAGGTGACTCGAT
ATCGAGTCACCTACACATGGAACAAATAAAGAAATCATATTCCGAGACCAAGCTATCTCCAACTTGATATGAAAAGAATAAATAATTACTTAAATTTTTT[G/T,TG]
AATAAGACGAATGGTCAAACACGTACTAAAAAGTCAACAGTGTCAAACATTTTAAAATGGAGGGAGTACAACTTAGCAGCGGAGGATAAACTTAGCATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.50% | 14.70% | 4.08% | 0.11% | CA: 4.61% |
| All Indica | 2759 | 66.50% | 24.50% | 6.67% | 0.18% | CA: 2.14% |
| All Japonica | 1512 | 89.40% | 0.20% | 0.26% | 0.00% | CA: 10.19% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.70% | 15.30% | 0.67% | 0.00% | CA: 2.35% |
| Indica II | 465 | 92.00% | 3.40% | 2.58% | 0.22% | CA: 1.72% |
| Indica III | 913 | 41.10% | 44.70% | 11.17% | 0.33% | CA: 2.74% |
| Indica Intermediate | 786 | 69.30% | 20.60% | 8.40% | 0.13% | CA: 1.53% |
| Temperate Japonica | 767 | 96.60% | 0.30% | 0.13% | 0.00% | CA: 3.00% |
| Tropical Japonica | 504 | 79.20% | 0.20% | 0.60% | 0.00% | CA: 20.04% |
| Japonica Intermediate | 241 | 87.60% | 0.00% | 0.00% | 0.00% | CA: 12.45% |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 6.70% | 5.56% | 0.00% | CA: 5.56% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215222085 | C -> CA | LOC_Os12g26140.1 | upstream_gene_variant ; 1434.0bp to feature; MODIFIER | silent_mutation | Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1215222085 | C -> CA | LOC_Os12g26120-LOC_Os12g26140 | intergenic_region ; MODIFIER | silent_mutation | Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1215222085 | C -> A | LOC_Os12g26140.1 | upstream_gene_variant ; 1435.0bp to feature; MODIFIER | silent_mutation | Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1215222085 | C -> A | LOC_Os12g26120-LOC_Os12g26140 | intergenic_region ; MODIFIER | silent_mutation | Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| vg1215222085 | C -> DEL | N | N | silent_mutation | Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215222085 | NA | 9.65E-06 | mr1060 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215222085 | NA | 1.72E-06 | mr1509 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215222085 | 2.25E-06 | 3.54E-07 | mr1579 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215222085 | NA | 6.65E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215222085 | NA | 1.28E-06 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215222085 | NA | 6.93E-06 | mr1216_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |