\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215222085:

Variant ID: vg1215222085 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 15222085
Reference Allele: CAlternative Allele: A,CA
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATGCTAAGTTTATCCTCCGCTGCTAAGTTGTACTCCCTCCATTTTAAAATGTTTGACACTGTTGACTTTTTAGTACGTGTTTGACCATTCGTCTTATT[C/A,CA]
AAAAAATTTAAGTAATTATTTATTCTTTTCATATCAAGTTGGAGATAGCTTGGTCTCGGAATATGATTTCTTTATTTGTTCCATGTGTAGGTGACTCGAT

Reverse complement sequence

ATCGAGTCACCTACACATGGAACAAATAAAGAAATCATATTCCGAGACCAAGCTATCTCCAACTTGATATGAAAAGAATAAATAATTACTTAAATTTTTT[G/T,TG]
AATAAGACGAATGGTCAAACACGTACTAAAAAGTCAACAGTGTCAAACATTTTAAAATGGAGGGAGTACAACTTAGCAGCGGAGGATAAACTTAGCATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.50% 14.70% 4.08% 0.11% CA: 4.61%
All Indica  2759 66.50% 24.50% 6.67% 0.18% CA: 2.14%
All Japonica  1512 89.40% 0.20% 0.26% 0.00% CA: 10.19%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 81.70% 15.30% 0.67% 0.00% CA: 2.35%
Indica II  465 92.00% 3.40% 2.58% 0.22% CA: 1.72%
Indica III  913 41.10% 44.70% 11.17% 0.33% CA: 2.74%
Indica Intermediate  786 69.30% 20.60% 8.40% 0.13% CA: 1.53%
Temperate Japonica  767 96.60% 0.30% 0.13% 0.00% CA: 3.00%
Tropical Japonica  504 79.20% 0.20% 0.60% 0.00% CA: 20.04%
Japonica Intermediate  241 87.60% 0.00% 0.00% 0.00% CA: 12.45%
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 82.20% 6.70% 5.56% 0.00% CA: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215222085 C -> CA LOC_Os12g26140.1 upstream_gene_variant ; 1434.0bp to feature; MODIFIER silent_mutation Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1215222085 C -> CA LOC_Os12g26120-LOC_Os12g26140 intergenic_region ; MODIFIER silent_mutation Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1215222085 C -> A LOC_Os12g26140.1 upstream_gene_variant ; 1435.0bp to feature; MODIFIER silent_mutation Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1215222085 C -> A LOC_Os12g26120-LOC_Os12g26140 intergenic_region ; MODIFIER silent_mutation Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg1215222085 C -> DEL N N silent_mutation Average:23.232; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215222085 NA 9.65E-06 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215222085 NA 1.72E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215222085 2.25E-06 3.54E-07 mr1579 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215222085 NA 6.65E-06 mr1621 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215222085 NA 1.28E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215222085 NA 6.93E-06 mr1216_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251