Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1215220184:

Variant ID: vg1215220184 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15220184
Reference Allele: GAlternative Allele: T,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCGACCTCTCGTGATGGAGGCACCCGCACCCTCCCCTCCACCATATCCGGTGGGAGGGCAGATGGCGGACCTCGGCGACGGTAGCGACAGCGGCCTGC[G/T,C]
GCCTCCTCTGCGCTAGATCAGGCAGGACAGGAGGCTGCAGACCTCGGCGGCGGTAGTGGTGGCGGCTGCACCCTCCCATTGCGGCGACGATGGCAGGGGT

Reverse complement sequence

ACCCCTGCCATCGTCGCCGCAATGGGAGGGTGCAGCCGCCACCACTACCGCCGCCGAGGTCTGCAGCCTCCTGTCCTGCCTGATCTAGCGCAGAGGAGGC[C/A,G]
GCAGGCCGCTGTCGCTACCGTCGCCGAGGTCCGCCATCTGCCCTCCCACCGGATATGGTGGAGGGGAGGGTGCGGGTGCCTCCATCACGAGAGGTCGCCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 47.90% 0.19% 0.00% C: 0.08%
All Indica  2759 59.60% 40.10% 0.18% 0.00% C: 0.14%
All Japonica  1512 28.30% 71.60% 0.13% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 88.90% 10.80% 0.34% 0.00% NA
Indica II  465 38.70% 61.30% 0.00% 0.00% NA
Indica III  913 56.80% 42.50% 0.22% 0.00% C: 0.44%
Indica Intermediate  786 52.90% 46.90% 0.13% 0.00% NA
Temperate Japonica  767 7.40% 92.60% 0.00% 0.00% NA
Tropical Japonica  504 56.30% 43.30% 0.40% 0.00% NA
Japonica Intermediate  241 36.10% 63.90% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 44.40% 54.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215220184 G -> C LOC_Os12g26140.1 upstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:63.005; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg1215220184 G -> C LOC_Os12g26120-LOC_Os12g26140 intergenic_region ; MODIFIER silent_mutation Average:63.005; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg1215220184 G -> T LOC_Os12g26140.1 upstream_gene_variant ; 3336.0bp to feature; MODIFIER silent_mutation Average:63.005; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N
vg1215220184 G -> T LOC_Os12g26120-LOC_Os12g26140 intergenic_region ; MODIFIER silent_mutation Average:63.005; most accessible tissue: Minghui63 young leaf, score: 82.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215220184 1.61E-08 3.38E-17 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 4.17E-08 1.23E-16 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 7.97E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 5.41E-09 1.01E-17 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.45E-07 5.43E-14 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 2.75E-06 6.55E-12 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 4.70E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.71E-06 2.29E-18 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 4.26E-07 NA mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.39E-08 6.81E-18 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 6.61E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 5.75E-10 4.66E-22 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 4.25E-10 3.00E-21 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 7.25E-07 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.92E-08 4.54E-21 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 2.08E-06 2.12E-16 mr1178 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.51E-11 9.53E-22 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.95E-07 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.91E-08 2.62E-20 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 5.12E-11 7.79E-21 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 6.98E-07 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 5.24E-08 2.12E-20 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 3.05E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 5.76E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 1.46E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 3.48E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.56E-07 1.85E-18 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 5.96E-11 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 1.40E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 1.08E-10 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 1.21E-06 3.31E-15 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 4.10E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 8.28E-09 5.91E-26 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 7.00E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 6.66E-08 8.93E-23 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 3.34E-06 2.10E-19 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 3.36E-07 3.03E-20 mr1178_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 3.58E-11 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 2.61E-07 1.30E-19 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 2.83E-06 1.74E-21 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 2.56E-07 1.55E-19 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 4.34E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 1.93E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 1.14E-17 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 2.66E-14 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215220184 NA 2.36E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251