| Variant ID: vg1215172595 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15172595 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCGACAGATACCGATTTTTCAAGTTTAAAACATGGTACCTTAAAGTACCTAAGTTAATAATAGGTATCAAAATGTGGGAGCACCTGGTAGCTCGTTAAGG[A/T]
CCGTAAAAATCACACTCTAGAGAGGTATATGCCATGTGTGTTTCTTATTCATCTGAATTTTGCCCTTTAATTAATTTCTCACCTGGTAGCTCTAGTGTGG
CCACACTAGAGCTACCAGGTGAGAAATTAATTAAAGGGCAAAATTCAGATGAATAAGAAACACACATGGCATATACCTCTCTAGAGTGTGATTTTTACGG[T/A]
CCTTAACGAGCTACCAGGTGCTCCCACATTTTGATACCTATTATTAACTTAGGTACTTTAAGGTACCATGTTTTAAACTTGAAAAATCGGTATCTGTCGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 4.90% | 3.49% | 0.11% | NA |
| All Indica | 2759 | 85.80% | 8.40% | 5.69% | 0.18% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 4.50% | 4.37% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.10% | 1.08% | 0.00% | NA |
| Indica III | 913 | 73.60% | 16.50% | 9.53% | 0.33% | NA |
| Indica Intermediate | 786 | 88.70% | 6.10% | 4.96% | 0.25% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215172595 | A -> DEL | N | N | silent_mutation | Average:27.969; most accessible tissue: Callus, score: 39.736 | N | N | N | N |
| vg1215172595 | A -> T | LOC_Os12g26090.1 | downstream_gene_variant ; 2623.0bp to feature; MODIFIER | silent_mutation | Average:27.969; most accessible tissue: Callus, score: 39.736 | N | N | N | N |
| vg1215172595 | A -> T | LOC_Os12g26090-LOC_Os12g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:27.969; most accessible tissue: Callus, score: 39.736 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215172595 | NA | 9.33E-07 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 2.08E-07 | mr1298 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 3.62E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | 3.90E-06 | 3.90E-06 | mr1450 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 1.46E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 2.96E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 3.43E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 7.02E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | NA | 1.67E-06 | mr1898 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172595 | 4.09E-07 | NA | mr1943 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |