\
| Variant ID: vg1215172477 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15172477 |
| Reference Allele: C | Alternative Allele: T,G |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 112. )
TGAATGATGCTATGCACATTTTGATCATCCTGTCCGATCGAAAGGTTTCTGCTATCACAATGTGCCACTGAGGTCACAATATATATGATCAGAGAAATTT[C/T,G]
ATGGTCTTTGAGAAGTACCGACAGATACCGATTTTTCAAGTTTAAAACATGGTACCTTAAAGTACCTAAGTTAATAATAGGTATCAAAATGTGGGAGCAC
GTGCTCCCACATTTTGATACCTATTATTAACTTAGGTACTTTAAGGTACCATGTTTTAAACTTGAAAAATCGGTATCTGTCGGTACTTCTCAAAGACCAT[G/A,C]
AAATTTCTCTGATCATATATATTGTGACCTCAGTGGCACATTGTGATAGCAGAAACCTTTCGATCGGACAGGATGATCAAAATGTGCATAGCATCATTCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 39.70% | 0.15% | 0.00% | G: 0.11% |
| All Indica | 2759 | 54.80% | 44.90% | 0.14% | 0.00% | G: 0.11% |
| All Japonica | 1512 | 82.20% | 17.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 6.70% | 92.60% | 0.37% | 0.00% | G: 0.37% |
| Indica I | 595 | 36.60% | 63.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.60% | 19.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 50.80% | 49.00% | 0.00% | 0.00% | G: 0.22% |
| Indica Intermediate | 786 | 57.90% | 41.60% | 0.38% | 0.00% | G: 0.13% |
| Temperate Japonica | 767 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 63.90% | 35.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 28.90% | 1.11% | 0.00% | G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215172477 | C -> G | LOC_Os12g26090.1 | downstream_gene_variant ; 2505.0bp to feature; MODIFIER | silent_mutation | Average:37.903; most accessible tissue: Callus, score: 59.353 | N | N | N | N |
| vg1215172477 | C -> G | LOC_Os12g26090-LOC_Os12g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:37.903; most accessible tissue: Callus, score: 59.353 | N | N | N | N |
| vg1215172477 | C -> T | LOC_Os12g26090.1 | downstream_gene_variant ; 2505.0bp to feature; MODIFIER | silent_mutation | Average:37.903; most accessible tissue: Callus, score: 59.353 | N | N | N | N |
| vg1215172477 | C -> T | LOC_Os12g26090-LOC_Os12g26100 | intergenic_region ; MODIFIER | silent_mutation | Average:37.903; most accessible tissue: Callus, score: 59.353 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215172477 | NA | 4.71E-08 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 8.42E-06 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.23E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 7.22E-06 | 8.93E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.81E-08 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.21E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 9.43E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.33E-06 | mr1289 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 7.20E-06 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 6.88E-07 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 1.99E-06 | 1.99E-06 | mr1353 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 5.48E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.94E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 6.10E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.54E-10 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 2.43E-06 | 2.42E-06 | mr1497 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 7.57E-07 | mr1500 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.17E-06 | mr1500 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.32E-06 | mr1514 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.55E-06 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.57E-06 | mr1549 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 6.90E-07 | mr1569 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.09E-07 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.81E-09 | mr1607 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.03E-06 | mr1607 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 8.92E-07 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.75E-06 | mr1635 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 2.26E-06 | 2.26E-06 | mr1635 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.16E-09 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 6.73E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.04E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 8.06E-11 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 4.53E-06 | 8.38E-15 | mr1866 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.41E-08 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 4.98E-06 | 1.29E-07 | mr1898 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.41E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.70E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.82E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.59E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.54E-06 | mr1227_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.33E-06 | mr1270_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 8.24E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.80E-06 | mr1272_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 6.19E-07 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 7.69E-07 | mr1354_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 7.08E-07 | 7.08E-07 | mr1356_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.96E-06 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.87E-06 | mr1388_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | 2.95E-06 | 2.95E-06 | mr1487_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 5.12E-07 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.44E-06 | mr1603_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 5.87E-12 | mr1607_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.16E-06 | mr1607_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.76E-17 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 2.55E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 1.17E-15 | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 4.94E-06 | mr1887_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 3.26E-07 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215172477 | NA | 9.79E-11 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |