\
| Variant ID: vg1215165691 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15165691 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTTGTGTAGCAGCAAAAACCCAGCTCCACCCCTGTAGTACAAATTTGTGGAGGTGCTCTGCTCCACAAAACAGAGAATTTGTACTGTTTGGCACAGCT[C/A,T]
CAGATCTAGGTAAGTTGGAGTTGGGAGCTGAAGGTGTGCCAAACAGGGCCTTATTGTGAAATTAATGCTTTTGTCACTTATAATTTTATTTCCAACTGCA
TGCAGTTGGAAATAAAATTATAAGTGACAAAAGCATTAATTTCACAATAAGGCCCTGTTTGGCACACCTTCAGCTCCCAACTCCAACTTACCTAGATCTG[G/T,A]
AGCTGTGCCAAACAGTACAAATTCTCTGTTTTGTGGAGCAGAGCACCTCCACAAATTTGTACTACAGGGGTGGAGCTGGGTTTTTGCTGCTACACAACTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.30% | 4.50% | 0.28% | 38.85% | T: 0.04% |
| All Indica | 2759 | 48.40% | 7.40% | 0.43% | 43.71% | T: 0.07% |
| All Japonica | 1512 | 82.30% | 0.10% | 0.00% | 17.59% | NA |
| Aus | 269 | 7.80% | 0.40% | 0.37% | 91.45% | NA |
| Indica I | 595 | 19.20% | 18.70% | 0.50% | 61.68% | NA |
| Indica II | 465 | 81.10% | 0.40% | 0.43% | 18.06% | NA |
| Indica III | 913 | 47.90% | 3.40% | 0.22% | 48.30% | T: 0.22% |
| Indica Intermediate | 786 | 51.70% | 7.80% | 0.64% | 39.95% | NA |
| Temperate Japonica | 767 | 95.40% | 0.10% | 0.00% | 4.43% | NA |
| Tropical Japonica | 504 | 64.50% | 0.20% | 0.00% | 35.32% | NA |
| Japonica Intermediate | 241 | 77.60% | 0.00% | 0.00% | 22.41% | NA |
| VI/Aromatic | 96 | 3.10% | 1.00% | 0.00% | 95.83% | NA |
| Intermediate | 90 | 66.70% | 4.40% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215165691 | C -> DEL | N | N | silent_mutation | Average:10.745; most accessible tissue: Callus, score: 58.27 | N | N | N | N |
| vg1215165691 | C -> A | LOC_Os12g26090.1 | upstream_gene_variant ; 3904.0bp to feature; MODIFIER | silent_mutation | Average:10.745; most accessible tissue: Callus, score: 58.27 | N | N | N | N |
| vg1215165691 | C -> A | LOC_Os12g26080-LOC_Os12g26090 | intergenic_region ; MODIFIER | silent_mutation | Average:10.745; most accessible tissue: Callus, score: 58.27 | N | N | N | N |
| vg1215165691 | C -> T | LOC_Os12g26090.1 | upstream_gene_variant ; 3904.0bp to feature; MODIFIER | silent_mutation | Average:10.745; most accessible tissue: Callus, score: 58.27 | N | N | N | N |
| vg1215165691 | C -> T | LOC_Os12g26080-LOC_Os12g26090 | intergenic_region ; MODIFIER | silent_mutation | Average:10.745; most accessible tissue: Callus, score: 58.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215165691 | NA | 2.16E-06 | mr1280 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.59E-07 | mr1280 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.60E-06 | mr1318 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.06E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.91E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.71E-07 | mr1040_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.20E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 9.43E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 7.80E-06 | 7.80E-06 | mr1054_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 9.51E-06 | 9.47E-06 | mr1058_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.92E-06 | mr1084_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.06E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.13E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 5.36E-06 | NA | mr1215_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.25E-09 | mr1215_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.54E-09 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.46E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.81E-06 | mr1283_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.75E-06 | mr1283_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 9.99E-06 | mr1288_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.25E-07 | mr1302_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.79E-06 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.33E-07 | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.76E-08 | mr1318_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.79E-06 | mr1345_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.01E-06 | mr1345_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.64E-06 | mr1362_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 5.42E-06 | 5.41E-06 | mr1366_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.32E-06 | mr1366_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 4.22E-06 | 4.22E-06 | mr1372_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 8.90E-06 | mr1396_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 9.00E-06 | mr1407_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.00E-06 | mr1421_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.79E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.89E-08 | mr1422_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 5.28E-06 | 5.28E-06 | mr1433_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 8.31E-06 | 8.29E-06 | mr1463_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 4.85E-06 | 4.84E-06 | mr1463_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.29E-06 | mr1466_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.06E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.66E-08 | mr1583_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 7.43E-06 | mr1604_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.87E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.25E-06 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 6.80E-06 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 7.54E-06 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.33E-06 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.16E-08 | mr1713_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.71E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.73E-07 | mr1729_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 8.66E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 9.26E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.56E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.05E-07 | mr1740_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.54E-06 | mr1751_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 5.75E-06 | 5.73E-06 | mr1752_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.49E-06 | mr1752_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.41E-06 | mr1759_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.04E-08 | mr1771_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.07E-06 | mr1784_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.80E-07 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.81E-06 | mr1785_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.73E-07 | mr1788_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.89E-08 | mr1788_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.65E-07 | mr1800_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.63E-06 | mr1813_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 9.16E-06 | mr1823_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 4.62E-06 | mr1823_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 3.46E-08 | mr1824_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 2.72E-06 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 5.31E-08 | mr1844_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 7.73E-06 | mr1854_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 1.07E-06 | mr1862_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 7.93E-06 | mr1876_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | 9.94E-06 | 9.90E-06 | mr1953_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215165691 | NA | 6.13E-06 | mr1986_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |