Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215126327:

Variant ID: vg1215126327 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15126327
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

GTCTCAGCTGATGGGGGTATTCATTTTTTAATAGGCCTTGACATCATTGAAAAATAACTTGAAGAGCAATACTTTTGTTAAGAAAAGGACAGTTTACCAA[C/T]
GTTCTTACAAGGATCACACCCCCAACCCTAGCACCTCACGCGCACCTTTTTAAGTAAAAAGAGGGACCTAGATGACGTCTTCATGGAAAGAAGCGACGAA

Reverse complement sequence

TTCGTCGCTTCTTTCCATGAAGACGTCATCTAGGTCCCTCTTTTTACTTAAAAAGGTGCGCGTGAGGTGCTAGGGTTGGGGGTGTGATCCTTGTAAGAAC[G/A]
TTGGTAAACTGTCCTTTTCTTAACAAAAGTATTGCTCTTCAAGTTATTTTTCAATGATGTCAAGGCCTATTAAAAAATGAATACCCCCATCAGCTGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.00%	32.90%	0.06%	0.00%	NA
All Indica	2759	61.10%	38.80%	0.07%	0.00%	NA
All Japonica	1512	76.00%	23.90%	0.07%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	77.00%	22.90%	0.17%	0.00%	NA
Indica II	465	17.80%	82.20%	0.00%	0.00%	NA
Indica III	913	72.20%	27.70%	0.11%	0.00%	NA
Indica Intermediate	786	61.80%	38.20%	0.00%	0.00%	NA
Temperate Japonica	767	90.50%	9.50%	0.00%	0.00%	NA
Tropical Japonica	504	58.50%	41.30%	0.20%	0.00%	NA
Japonica Intermediate	241	66.40%	33.60%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	66.70%	0.00%	0.00%	NA
Intermediate	90	63.30%	36.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215126327	C -> T	LOC_Os12g26040.1	upstream_gene_variant ; 354.0bp to feature; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1215126327	C -> T	LOC_Os12g26030.1	downstream_gene_variant ; 1720.0bp to feature; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1215126327	C -> T	LOC_Os12g26044.1	downstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1215126327	C -> T	LOC_Os12g26044.2	downstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1215126327	C -> T	LOC_Os12g26044.3	downstream_gene_variant ; 1205.0bp to feature; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N
vg1215126327	C -> T	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.985; most accessible tissue: Zhenshan97 panicle, score: 79.071	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215126327	NA	2.53E-06	mr1280	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	1.06E-06	mr1298	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	7.40E-07	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	7.36E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	4.79E-06	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	1.56E-06	mr1633_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	9.02E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215126327	NA	3.59E-06	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251