Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215125172:

Variant ID: vg1215125172 (JBrowse)	Variation Type: INDEL
Chromosome: chr12	Position: 15125172
Reference Allele: T	Alternative Allele: A,TA,TTA,TAA,TTTA,TTAA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAGAATTATTGTTGATAGCTAAAGAATTTCAGTTTTGATCTAACTTATGAACGACACCATTGCCTTTTGCAATTTGACTAAACATAAGTTTTTTTTT[T/A,TA,TTA,TAA,TTTA,TTAA]
AAAAAAAAACAGGAACTGGAAACAGGAGCTTCCATTAATCACAGGCTCAATTCTCTTTTTATTTTGAATTGCAGTAGACTCCTGCGCAAGTTTTAGGACA

Reverse complement sequence

TGTCCTAAAACTTGCGCAGGAGTCTACTGCAATTCAAAATAAAAAGAGAATTGAGCCTGTGATTAATGGAAGCTCCTGTTTCCAGTTCCTGTTTTTTTTT[A/T,TA,TAA,TTA,TAAA,TTAA]
AAAAAAAAACTTATGTTTAGTCAAATTGCAAAAGGCAATGGTGTCGTTCATAAGTTAGATCAAAACTGAAATTCTTTAGCTATCAACAATAATTCTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	26.30%	2.16%	0.00%	TAA: 5.80%; TTA: 1.65%; TA: 1.63%; TTTA: 0.99%; TTAA: 0.61%
All Indica	2759	52.70%	34.80%	1.74%	0.00%	TAA: 4.82%; TA: 2.57%; TTTA: 1.23%; TTA: 1.16%; TTAA: 1.05%
All Japonica	1512	72.80%	16.90%	1.98%	0.00%	TAA: 7.08%; TTA: 1.19%; TA: 0.13%
Aus	269	85.50%	2.20%	1.12%	0.00%	TAA: 5.95%; TTTA: 4.09%; TTA: 0.74%; TA: 0.37%
Indica I	595	63.20%	21.70%	1.85%	0.00%	TAA: 5.71%; TA: 4.03%; TTTA: 3.36%; TTA: 0.17%
Indica II	465	15.50%	71.40%	1.72%	0.00%	TAA: 9.25%; TA: 1.08%; TTAA: 0.86%; TTA: 0.22%
Indica III	913	67.00%	23.40%	0.99%	0.00%	TTA: 2.41%; TTAA: 1.86%; TA: 1.75%; TAA: 1.53%; TTTA: 0.99%
Indica Intermediate	786	50.00%	36.10%	2.54%	0.00%	TAA: 5.34%; TA: 3.31%; TTAA: 1.02%; TTA: 1.02%; TTTA: 0.64%
Temperate Japonica	767	87.10%	9.60%	1.43%	0.00%	TAA: 1.83%
Tropical Japonica	504	55.60%	26.40%	1.98%	0.00%	TAA: 14.29%; TTA: 1.59%; TA: 0.20%
Japonica Intermediate	241	63.10%	19.90%	3.73%	0.00%	TAA: 8.71%; TTA: 4.15%; TA: 0.41%
VI/Aromatic	96	42.70%	2.10%	16.67%	0.00%	TTA: 22.92%; TAA: 13.54%; TA: 2.08%
Intermediate	90	57.80%	23.30%	5.56%	0.00%	TAA: 5.56%; TTA: 4.44%; TTTA: 2.22%; TA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215125172	T -> A	LOC_Os12g26040.1	upstream_gene_variant ; 1509.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> A	LOC_Os12g26030.1	downstream_gene_variant ; 565.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> A	LOC_Os12g26044.1	downstream_gene_variant ; 2360.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> A	LOC_Os12g26044.2	downstream_gene_variant ; 2360.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> A	LOC_Os12g26044.3	downstream_gene_variant ; 2360.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> A	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26040.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26030.1	downstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26044.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26044.2	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26044.3	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TAA	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26040.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26030.1	downstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26044.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26044.2	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26044.3	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTA	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26040.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26030.1	downstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26044.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26044.2	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26044.3	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TA	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26040.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26030.1	downstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26044.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26044.2	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26044.3	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTAA	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26040.1	upstream_gene_variant ; 1508.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26030.1	downstream_gene_variant ; 566.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26044.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26044.2	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26044.3	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1215125172	T -> TTTA	LOC_Os12g26030-LOC_Os12g26040	intergenic_region ; MODIFIER	silent_mutation	Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215125172	1.30E-09	1.30E-09	mr1024_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172	1.50E-06	2.06E-07	mr1565_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172	3.14E-06	3.14E-06	mr1930_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172	2.02E-06	2.02E-06	mr1940_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251