\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215125172:

Variant ID: vg1215125172 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 15125172
Reference Allele: TAlternative Allele: A,TA,TTA,TAA,TTTA,TTAA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAGAATTATTGTTGATAGCTAAAGAATTTCAGTTTTGATCTAACTTATGAACGACACCATTGCCTTTTGCAATTTGACTAAACATAAGTTTTTTTTT[T/A,TA,TTA,TAA,TTTA,TTAA]
AAAAAAAAACAGGAACTGGAAACAGGAGCTTCCATTAATCACAGGCTCAATTCTCTTTTTATTTTGAATTGCAGTAGACTCCTGCGCAAGTTTTAGGACA

Reverse complement sequence

TGTCCTAAAACTTGCGCAGGAGTCTACTGCAATTCAAAATAAAAAGAGAATTGAGCCTGTGATTAATGGAAGCTCCTGTTTCCAGTTCCTGTTTTTTTTT[A/T,TA,TAA,TTA,TAAA,TTAA]
AAAAAAAAACTTATGTTTAGTCAAATTGCAAAAGGCAATGGTGTCGTTCATAAGTTAGATCAAAACTGAAATTCTTTAGCTATCAACAATAATTCTTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 26.30% 2.16% 0.00% TAA: 5.80%; TTA: 1.65%; TA: 1.63%; TTTA: 0.99%; TTAA: 0.61%
All Indica  2759 52.70% 34.80% 1.74% 0.00% TAA: 4.82%; TA: 2.57%; TTTA: 1.23%; TTA: 1.16%; TTAA: 1.05%
All Japonica  1512 72.80% 16.90% 1.98% 0.00% TAA: 7.08%; TTA: 1.19%; TA: 0.13%
Aus  269 85.50% 2.20% 1.12% 0.00% TAA: 5.95%; TTTA: 4.09%; TTA: 0.74%; TA: 0.37%
Indica I  595 63.20% 21.70% 1.85% 0.00% TAA: 5.71%; TA: 4.03%; TTTA: 3.36%; TTA: 0.17%
Indica II  465 15.50% 71.40% 1.72% 0.00% TAA: 9.25%; TA: 1.08%; TTAA: 0.86%; TTA: 0.22%
Indica III  913 67.00% 23.40% 0.99% 0.00% TTA: 2.41%; TTAA: 1.86%; TA: 1.75%; TAA: 1.53%; TTTA: 0.99%
Indica Intermediate  786 50.00% 36.10% 2.54% 0.00% TAA: 5.34%; TA: 3.31%; TTAA: 1.02%; TTA: 1.02%; TTTA: 0.64%
Temperate Japonica  767 87.10% 9.60% 1.43% 0.00% TAA: 1.83%
Tropical Japonica  504 55.60% 26.40% 1.98% 0.00% TAA: 14.29%; TTA: 1.59%; TA: 0.20%
Japonica Intermediate  241 63.10% 19.90% 3.73% 0.00% TAA: 8.71%; TTA: 4.15%; TA: 0.41%
VI/Aromatic  96 42.70% 2.10% 16.67% 0.00% TTA: 22.92%; TAA: 13.54%; TA: 2.08%
Intermediate  90 57.80% 23.30% 5.56% 0.00% TAA: 5.56%; TTA: 4.44%; TTTA: 2.22%; TA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215125172 T -> A LOC_Os12g26040.1 upstream_gene_variant ; 1509.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> A LOC_Os12g26030.1 downstream_gene_variant ; 565.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> A LOC_Os12g26044.1 downstream_gene_variant ; 2360.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> A LOC_Os12g26044.2 downstream_gene_variant ; 2360.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> A LOC_Os12g26044.3 downstream_gene_variant ; 2360.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> A LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26040.1 upstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26030.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26044.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26044.2 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26044.3 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TAA LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26040.1 upstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26030.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26044.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26044.2 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26044.3 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTA LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26040.1 upstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26030.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26044.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26044.2 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26044.3 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TA LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26040.1 upstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26030.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26044.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26044.2 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26044.3 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTAA LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26040.1 upstream_gene_variant ; 1508.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26030.1 downstream_gene_variant ; 566.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26044.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26044.2 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26044.3 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg1215125172 T -> TTTA LOC_Os12g26030-LOC_Os12g26040 intergenic_region ; MODIFIER silent_mutation Average:68.07; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215125172 1.30E-09 1.30E-09 mr1024_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172 1.50E-06 2.06E-07 mr1565_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172 3.14E-06 3.14E-06 mr1930_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215125172 2.02E-06 2.02E-06 mr1940_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251