\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215113004:

Variant ID: vg1215113004 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15113004
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCTCACCAAGCTAGAGCTTGGCGTGCTTCTCCGCTCGCTCAAGCTCCTTCGCTTGCTCAGCCTCCGCCTAGCCGCCGAGGATGAGATCCATGCCCTCCT[C/T]
GCCATCATGGAGCTCGGCGCATTCCTTCACTCACTCCTCCTCCGCCCGGCTGCCAGGGATGAGATCAATGCCTTCATGTCGGCATGGAGTTCGGCGCGCT

Reverse complement sequence

AGCGCGCCGAACTCCATGCCGACATGAAGGCATTGATCTCATCCCTGGCAGCCGGGCGGAGGAGGAGTGAGTGAAGGAATGCGCCGAGCTCCATGATGGC[G/A]
AGGAGGGCATGGATCTCATCCTCGGCGGCTAGGCGGAGGCTGAGCAAGCGAAGGAGCTTGAGCGAGCGGAGAAGCACGCCAAGCTCTAGCTTGGTGAGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.40% 0.02% 0.00% NA
All Indica  2759 76.00% 24.00% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 79.00% 21.00% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 60.70% 39.30% 0.00% 0.00% NA
Indica Intermediate  786 80.00% 19.80% 0.13% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215113004 C -> T LOC_Os12g26010.1 synonymous_variant ; p.Leu192Leu; LOW synonymous_codon Average:81.414; most accessible tissue: Minghui63 young leaf, score: 92.217 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1215113004 C T -0.02 -0.03 -0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215113004 NA 2.81E-07 mr1060 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215113004 NA 2.25E-06 mr1298 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215113004 1.61E-06 1.61E-06 mr1339 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215113004 NA 1.88E-06 mr1594 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215113004 NA 4.03E-06 mr1671 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215113004 NA 1.73E-06 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251