Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215099338:

Variant ID: vg1215099338 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15099338
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAACTAATTCATCTTAGCTCGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGATCTACATGTTAAAAATATCCACATGTACTGTTCATGC[C/T]
TGTTTATGTGCTGTTTTGGTGATTTTGCTCCTTTCTGTCTAGATTCCGACGTTTCCGGAGAGTCCGTTTTTGCAGGAAAAAAATTTGAAGAGTTCCAAGG

Reverse complement sequence

CCTTGGAACTCTTCAAATTTTTTTCCTGCAAAAACGGACTCTCCGGAAACGTCGGAATCTAGACAGAAAGGAGCAAAATCACCAAAACAGCACATAAACA[G/A]
GCATGAACAGTACATGTGGATATTTTTAACATGTAGATCTCAATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCGAGCTAAGATGAATTAGTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.20%	0.10%	1.65%	73.00%	NA
All Indica	2759	4.70%	0.20%	2.36%	92.75%	NA
All Japonica	1512	67.10%	0.10%	0.26%	32.54%	NA
Aus	269	5.20%	0.00%	2.60%	92.19%	NA
Indica I	595	4.90%	0.20%	2.02%	92.94%	NA
Indica II	465	4.90%	0.20%	1.72%	93.12%	NA
Indica III	913	2.80%	0.30%	2.08%	94.74%	NA
Indica Intermediate	786	6.50%	0.10%	3.31%	90.08%	NA
Temperate Japonica	767	88.30%	0.00%	0.26%	11.47%	NA
Tropical Japonica	504	39.70%	0.20%	0.20%	59.92%	NA
Japonica Intermediate	241	57.30%	0.00%	0.41%	42.32%	NA
VI/Aromatic	96	0.00%	0.00%	1.04%	98.96%	NA
Intermediate	90	36.70%	0.00%	1.11%	62.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215099338	C -> DEL	N	N	silent_mutation	Average:6.707; most accessible tissue: Callus, score: 22.433	N	N	N	N
vg1215099338	C -> T	LOC_Os12g26000.1	upstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:6.707; most accessible tissue: Callus, score: 22.433	N	N	N	N
vg1215099338	C -> T	LOC_Os12g25990.1	downstream_gene_variant ; 3732.0bp to feature; MODIFIER	silent_mutation	Average:6.707; most accessible tissue: Callus, score: 22.433	N	N	N	N
vg1215099338	C -> T	LOC_Os12g26000-LOC_Os12g26010	intergenic_region ; MODIFIER	silent_mutation	Average:6.707; most accessible tissue: Callus, score: 22.433	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215099338	NA	9.52E-12	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	3.09E-13	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.83E-11	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.49E-12	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	3.94E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.15E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	7.03E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	6.48E-13	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	2.58E-13	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.24E-06	mr1553	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.39E-07	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.27E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.14E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.00E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.99E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	3.31E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	5.37E-06	5.37E-06	mr1230_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.48E-08	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.98E-10	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	9.98E-06	9.98E-06	mr1326_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	2.13E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	6.68E-06	6.67E-06	mr1407_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	2.45E-06	4.58E-08	mr1415_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	3.89E-07	3.89E-07	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.76E-16	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.65E-07	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.18E-08	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	8.69E-09	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	1.97E-07	1.97E-07	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.02E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.90E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	3.00E-06	1.61E-09	mr1623_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.44E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.33E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	2.13E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	7.33E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	1.97E-06	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	2.46E-06	2.46E-06	mr1869_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	8.63E-06	8.63E-06	mr1876_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	2.65E-06	2.51E-08	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	4.20E-06	8.08E-10	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	4.48E-09	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215099338	NA	5.87E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251