\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215096865:

Variant ID: vg1215096865 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 15096865
Reference Allele: GAlternative Allele: A,GATTT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCACCAAAATCATCTATTATATTCATTCTCTCTTGTGATCTAATCGTATTGTCATCAATCACCAAAAAGGGAGAGATTGAAAGTGCATCTAGGCCCTTA[G/A,GATTT]
TGATCGTCAAGGTTGCTACGGCCCCGTCGTCATCTTCGTCCATGCCTCCGCGTCGTCAAGCGTTGCGCCGGTCGTGTCTCGCCTTCGTCCAAAGATCACC

Reverse complement sequence

GGTGATCTTTGGACGAAGGCGAGACACGACCGGCGCAACGCTTGACGACGCGGAGGCATGGACGAAGATGACGACGGGGCCGTAGCAACCTTGACGATCA[C/T,AAATC]
TAAGGGCCTAGATGCACTTTCAATCTCTCCCTTTTTGGTGATTGATGACAATACGATTAGATCACAAGAGAGAATGAATATAATAGATGATTTTGGTGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 21.10% 12.31% 40.73% GATTT: 0.57%
All Indica  2759 4.60% 28.30% 17.91% 48.24% GATTT: 0.91%
All Japonica  1512 67.30% 13.20% 4.10% 15.28% GATTT: 0.13%
Aus  269 5.20% 1.50% 3.35% 89.96% NA
Indica I  595 7.40% 27.70% 25.71% 38.66% GATTT: 0.50%
Indica II  465 4.70% 32.00% 16.13% 46.24% GATTT: 0.86%
Indica III  913 1.40% 25.70% 13.58% 57.94% GATTT: 1.31%
Indica Intermediate  786 6.20% 29.50% 18.07% 45.42% GATTT: 0.76%
Temperate Japonica  767 88.50% 5.00% 2.35% 4.04% GATTT: 0.13%
Tropical Japonica  504 39.50% 23.00% 6.15% 31.15% GATTT: 0.20%
Japonica Intermediate  241 57.70% 19.10% 5.39% 17.84% NA
VI/Aromatic  96 0.00% 1.00% 1.04% 97.92% NA
Intermediate  90 38.90% 13.30% 17.78% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215096865 G -> DEL N N silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> A LOC_Os12g25990.1 downstream_gene_variant ; 1259.0bp to feature; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> A LOC_Os12g26000.1 downstream_gene_variant ; 1793.0bp to feature; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> A LOC_Os12g25990-LOC_Os12g26000 intergenic_region ; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> GATTT LOC_Os12g25990.1 downstream_gene_variant ; 1260.0bp to feature; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> GATTT LOC_Os12g26000.1 downstream_gene_variant ; 1792.0bp to feature; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N
vg1215096865 G -> GATTT LOC_Os12g25990-LOC_Os12g26000 intergenic_region ; MODIFIER silent_mutation Average:9.685; most accessible tissue: Callus, score: 23.494 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215096865 NA 2.18E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.95E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.72E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 6.50E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.93E-08 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.73E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.05E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.39E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 7.94E-06 NA mr1289_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 2.09E-06 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 5.73E-06 5.73E-06 mr1299_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 2.12E-06 2.12E-06 mr1345_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 2.07E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.37E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.24E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 2.78E-06 2.78E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 7.65E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 6.52E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 1.12E-06 1.12E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.33E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 7.51E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 1.68E-06 1.68E-06 mr1511_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.54E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.21E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 8.05E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 2.89E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.39E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 4.24E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.21E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 2.49E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.74E-10 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 2.20E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.92E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 9.82E-09 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 3.12E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 1.01E-06 1.01E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 7.36E-06 1.32E-08 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 4.52E-08 mr1879_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.13E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 4.89E-09 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 4.63E-06 2.28E-14 mr1916_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.11E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 1.90E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215096865 NA 5.66E-08 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251