\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215091766:

Variant ID: vg1215091766 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15091766
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.19, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAGAAGCTTGAGAAGAACGAGAAGCACAAGCATAGCAAGCATGATCGCTATGGCCAAGCTCACCTTGGGGTGATCTTCGGCTCCGACTTCGAGTCAAG[C/T]
TCAAGTGATGAAGAAGGAGTTGCCACATTCGCCGTCAAGCCTTCATCACCACCGAGACTCTTCAACTACTCAAGTGATGAGGATGCTCCCATTTGCCTCA

Reverse complement sequence

TGAGGCAAATGGGAGCATCCTCATCACTTGAGTAGTTGAAGAGTCTCGGTGGTGATGAAGGCTTGACGGCGAATGTGGCAACTCCTTCTTCATCACTTGA[G/A]
CTTGACTCGAAGTCGGAGCCGAAGATCACCCCAAGGTGAGCTTGGCCATAGCGATCATGCTTGCTATGCTTGTGCTTCTCGTTCTTCTCAAGCTTCTTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 23.80% 3.75% 47.12% NA
All Indica  2759 4.90% 34.00% 4.49% 56.61% NA
All Japonica  1512 66.80% 10.90% 2.58% 19.71% NA
Aus  269 6.30% 3.00% 2.23% 88.48% NA
Indica I  595 5.40% 50.10% 1.85% 42.69% NA
Indica II  465 5.40% 27.10% 5.38% 62.15% NA
Indica III  913 3.30% 26.10% 5.48% 65.17% NA
Indica Intermediate  786 6.20% 35.00% 4.83% 53.94% NA
Temperate Japonica  767 87.70% 4.60% 1.30% 6.39% NA
Tropical Japonica  504 39.50% 17.90% 4.37% 38.29% NA
Japonica Intermediate  241 57.30% 16.60% 2.90% 23.24% NA
VI/Aromatic  96 0.00% 1.00% 2.08% 96.88% NA
Intermediate  90 36.70% 16.70% 6.67% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215091766 C -> DEL LOC_Os12g25990.1 N frameshift_variant Average:10.733; most accessible tissue: Callus, score: 32.523 N N N N
vg1215091766 C -> T LOC_Os12g25990.1 synonymous_variant ; p.Ser372Ser; LOW synonymous_codon Average:10.733; most accessible tissue: Callus, score: 32.523 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215091766 9.83E-06 1.69E-11 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 3.40E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.77E-12 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 8.39E-07 NA mr1019 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 9.17E-12 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.19E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 3.41E-12 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 9.20E-06 NA mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 4.17E-06 4.63E-12 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 4.46E-06 6.18E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 2.16E-06 mr1772 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.31E-09 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.12E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.19E-11 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 2.41E-14 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 4.12E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 2.23E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 7.91E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 5.22E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.33E-15 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 2.09E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.02E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 9.34E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 1.56E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 8.64E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 9.64E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766 NA 7.60E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251