Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215091766:

Variant ID: vg1215091766 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15091766
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.19, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAGAAGCTTGAGAAGAACGAGAAGCACAAGCATAGCAAGCATGATCGCTATGGCCAAGCTCACCTTGGGGTGATCTTCGGCTCCGACTTCGAGTCAAG[C/T]
TCAAGTGATGAAGAAGGAGTTGCCACATTCGCCGTCAAGCCTTCATCACCACCGAGACTCTTCAACTACTCAAGTGATGAGGATGCTCCCATTTGCCTCA

Reverse complement sequence

TGAGGCAAATGGGAGCATCCTCATCACTTGAGTAGTTGAAGAGTCTCGGTGGTGATGAAGGCTTGACGGCGAATGTGGCAACTCCTTCTTCATCACTTGA[G/A]
CTTGACTCGAAGTCGGAGCCGAAGATCACCCCAAGGTGAGCTTGGCCATAGCGATCATGCTTGCTATGCTTGTGCTTCTCGTTCTTCTCAAGCTTCTTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.30%	23.80%	3.75%	47.12%	NA
All Indica	2759	4.90%	34.00%	4.49%	56.61%	NA
All Japonica	1512	66.80%	10.90%	2.58%	19.71%	NA
Aus	269	6.30%	3.00%	2.23%	88.48%	NA
Indica I	595	5.40%	50.10%	1.85%	42.69%	NA
Indica II	465	5.40%	27.10%	5.38%	62.15%	NA
Indica III	913	3.30%	26.10%	5.48%	65.17%	NA
Indica Intermediate	786	6.20%	35.00%	4.83%	53.94%	NA
Temperate Japonica	767	87.70%	4.60%	1.30%	6.39%	NA
Tropical Japonica	504	39.50%	17.90%	4.37%	38.29%	NA
Japonica Intermediate	241	57.30%	16.60%	2.90%	23.24%	NA
VI/Aromatic	96	0.00%	1.00%	2.08%	96.88%	NA
Intermediate	90	36.70%	16.70%	6.67%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215091766	C -> DEL	LOC_Os12g25990.1	N	frameshift_variant	Average:10.733; most accessible tissue: Callus, score: 32.523	N	N	N	N
vg1215091766	C -> T	LOC_Os12g25990.1	synonymous_variant ; p.Ser372Ser; LOW	synonymous_codon	Average:10.733; most accessible tissue: Callus, score: 32.523	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215091766	9.83E-06	1.69E-11	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	3.40E-11	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.77E-12	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	8.39E-07	NA	mr1019	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	9.17E-12	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.19E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	3.41E-12	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	9.20E-06	NA	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	4.17E-06	4.63E-12	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	4.46E-06	6.18E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	2.16E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.31E-09	mr1019_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.12E-09	mr1022_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.19E-11	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	2.41E-14	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	4.12E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	2.23E-08	mr1261_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	7.91E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	5.22E-07	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.33E-15	mr1489_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	2.09E-14	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.02E-06	mr1554_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	9.34E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	1.56E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	8.64E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	9.64E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215091766	NA	7.60E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251