\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215079782:

Variant ID: vg1215079782 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15079782
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGGTGTGTTTCAACTGTGGAGACCCAGGACATTACGCTGACAAGTGTCCGAAGCCCCGATGCGTGAAGGTTGTCCCTGCCCAGAGCAACTCTACCGTA[T/C]
CAGCATCAAAGGCCCGTGTCAATCATGTTGCTGCTGCAGAAGCTCAAGGTGCTCCAGATGTGATTTTGGGTACGTTTCTTGTTAACTCAGTTCCTGCAAC

Reverse complement sequence

GTTGCAGGAACTGAGTTAACAAGAAACGTACCCAAAATCACATCTGGAGCACCTTGAGCTTCTGCAGCAGCAACATGATTGACACGGGCCTTTGATGCTG[A/G]
TACGGTAGAGTTGCTCTGGGCAGGGACAACCTTCACGCATCGGGGCTTCGGACACTTGTCAGCGTAATGTCCTGGGTCTCCACAGTTGAAACACACCACG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 26.00% 32.37% 7.45% NA
All Indica  2759 16.40% 40.10% 41.25% 2.25% NA
All Japonica  1512 68.10% 2.10% 11.57% 18.19% NA
Aus  269 27.50% 21.90% 48.70% 1.86% NA
Indica I  595 9.90% 31.10% 56.97% 2.02% NA
Indica II  465 12.50% 47.10% 35.70% 4.73% NA
Indica III  913 20.80% 43.60% 35.16% 0.44% NA
Indica Intermediate  786 18.40% 38.80% 39.69% 3.05% NA
Temperate Japonica  767 88.40% 0.40% 2.22% 9.00% NA
Tropical Japonica  504 42.10% 5.00% 23.21% 29.76% NA
Japonica Intermediate  241 58.10% 1.70% 17.01% 23.24% NA
VI/Aromatic  96 19.80% 13.50% 62.50% 4.17% NA
Intermediate  90 42.20% 22.20% 28.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215079782 T -> C LOC_Os12g25980.1 missense_variant ; p.Ser563Pro; MODERATE nonsynonymous_codon ; S563P Average:14.255; most accessible tissue: Minghui63 young leaf, score: 23.613 benign -0.329 TOLERATED 1.00
vg1215079782 T -> DEL LOC_Os12g25980.1 N frameshift_variant Average:14.255; most accessible tissue: Minghui63 young leaf, score: 23.613 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215079782 NA 3.45E-07 mr1243 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.04E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 6.91E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 2.24E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.79E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 2.74E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 7.78E-06 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 3.90E-08 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.29E-08 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 2.29E-06 2.28E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 6.09E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 7.82E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 7.01E-07 7.00E-07 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 9.29E-06 9.28E-06 mr1511_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 2.14E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 4.90E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 9.90E-06 9.89E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.53E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 7.96E-10 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.25E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.58E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 3.06E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 8.03E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.01E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 3.90E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 6.44E-06 6.44E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.02E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.21E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 3.11E-06 3.11E-06 mr1901_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 3.78E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.68E-06 mr1924_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 5.46E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215079782 NA 1.53E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251