Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215077450:

Variant ID: vg1215077450 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 15077450
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATTTATTCCAGTGTTATTAGTACTGTACATCTATTACTGTACTAATGGCTCATTTTACCAGCAAAAGTTTTACAATATTGTTTTATTTAATCTTGCT[G/A]
CAAGAAAATAAATTTAGCATGTTGATTTTATAACTTTCTTTTATCTCTGTTGGAACCTGTTGTTCAAAAGTACAAAATTTGTGACCTTATTTCCAACTGT

Reverse complement sequence

ACAGTTGGAAATAAGGTCACAAATTTTGTACTTTTGAACAACAGGTTCCAACAGAGATAAAAGAAAGTTATAAAATCAACATGCTAAATTTATTTTCTTG[C/T]
AGCAAGATTAAATAAAACAATATTGTAAAACTTTTGCTGGTAAAATGAGCCATTAGTACAGTAATAGATGTACAGTACTAATAACACTGGAATAAATTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	0.30%	1.16%	6.52%	NA
All Indica	2759	98.80%	0.00%	0.25%	0.98%	NA
All Japonica	1512	79.20%	0.80%	2.98%	17.06%	NA
Aus	269	96.30%	0.00%	0.74%	2.97%	NA
Indica I	595	98.80%	0.00%	0.00%	1.18%	NA
Indica II	465	97.00%	0.00%	0.65%	2.37%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	0.00%	0.38%	1.15%	NA
Temperate Japonica	767	91.70%	0.10%	0.39%	7.82%	NA
Tropical Japonica	504	61.90%	2.20%	7.54%	28.37%	NA
Japonica Intermediate	241	75.50%	0.00%	1.66%	22.82%	NA
VI/Aromatic	96	86.50%	3.10%	0.00%	10.42%	NA
Intermediate	90	93.30%	0.00%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1215077450	G -> DEL	N	N	silent_mutation	Average:9.775; most accessible tissue: Callus, score: 17.488	N	N	N	N
vg1215077450	G -> A	LOC_Os12g25959.1	upstream_gene_variant ; 3813.0bp to feature; MODIFIER	silent_mutation	Average:9.775; most accessible tissue: Callus, score: 17.488	N	N	N	N
vg1215077450	G -> A	LOC_Os12g25968.1	upstream_gene_variant ; 2474.0bp to feature; MODIFIER	silent_mutation	Average:9.775; most accessible tissue: Callus, score: 17.488	N	N	N	N
vg1215077450	G -> A	LOC_Os12g25980.1	intron_variant ; MODIFIER	silent_mutation	Average:9.775; most accessible tissue: Callus, score: 17.488	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1215077450	NA	9.39E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	5.18E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	1.01E-06	1.01E-06	mr1424_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	9.88E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	1.23E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	6.44E-06	mr1819_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	4.57E-08	4.57E-08	mr1846_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	3.63E-06	mr1860_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	2.61E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	NA	5.09E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215077450	5.84E-06	5.84E-06	mr1938_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251