\
| Variant ID: vg1215060377 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15060377 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 80. )
ACGCCGTATTCCCCGGCGAGCTGGTGCAGGCCGGTGTAGGTGACACGCAGGGAGCCGCGGATCTCCGACAAGCGGTTCTCGAGCTCTGACATACGGTGCT[C/T]
GAGCCCCTGCCGTTGTCGCTCATTGCCAGCCACCAGCTCCTGCATCTTCTGGAGGTCCTCGCAAACCTCCGCTAAGTCGCGCGCCAGCCGGTCGGCGCGC
GCGCGCCGACCGGCTGGCGCGCGACTTAGCGGAGGTTTGCGAGGACCTCCAGAAGATGCAGGAGCTGGTGGCTGGCAATGAGCGACAACGGCAGGGGCTC[G/A]
AGCACCGTATGTCAGAGCTCGAGAACCGCTTGTCGGAGATCCGCGGCTCCCTGCGTGTCACCTACACCGGCCTGCACCAGCTCGCCGGGGAATACGGCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.60% | 24.70% | 17.27% | 9.48% | NA |
| All Indica | 2759 | 25.80% | 31.50% | 27.47% | 15.26% | NA |
| All Japonica | 1512 | 81.00% | 17.80% | 0.60% | 0.66% | NA |
| Aus | 269 | 87.70% | 2.60% | 7.06% | 2.60% | NA |
| Indica I | 595 | 27.60% | 8.90% | 16.30% | 47.23% | NA |
| Indica II | 465 | 24.90% | 45.20% | 25.59% | 4.30% | NA |
| Indica III | 913 | 23.70% | 37.30% | 36.80% | 2.19% | NA |
| Indica Intermediate | 786 | 27.50% | 33.60% | 26.21% | 12.72% | NA |
| Temperate Japonica | 767 | 91.00% | 8.30% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 68.80% | 29.40% | 0.40% | 1.39% | NA |
| Japonica Intermediate | 241 | 74.30% | 23.70% | 1.24% | 0.83% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 23.96% | 5.21% | NA |
| Intermediate | 90 | 63.30% | 23.30% | 7.78% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215060377 | C -> DEL | LOC_Os12g25940.1 | N | frameshift_variant | Average:39.005; most accessible tissue: Minghui63 young leaf, score: 78.821 | N | N | N | N |
| vg1215060377 | C -> T | LOC_Os12g25940.1 | missense_variant ; p.Glu333Lys; MODERATE | nonsynonymous_codon ; E333K | Average:39.005; most accessible tissue: Minghui63 young leaf, score: 78.821 | unknown | unknown | DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215060377 | NA | 1.35E-09 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 3.19E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 2.32E-07 | mr1603 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 7.82E-09 | mr1022_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 6.20E-07 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.12E-13 | mr1132_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 8.69E-07 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 4.39E-07 | mr1232_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 7.90E-09 | mr1261_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | 9.43E-06 | 9.43E-06 | mr1407_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 8.78E-07 | mr1415_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 3.54E-09 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | 1.95E-06 | 1.95E-06 | mr1424_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 2.18E-07 | mr1557_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.75E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.18E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 5.24E-07 | mr1653_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.97E-08 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 7.49E-06 | mr1702_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 7.14E-09 | mr1830_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | 6.04E-06 | 6.04E-06 | mr1869_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.09E-06 | mr1873_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.74E-07 | mr1884_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 3.59E-08 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 1.26E-11 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 3.76E-10 | mr1942_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215060377 | NA | 6.48E-07 | mr1944_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |