\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215060377:

Variant ID: vg1215060377 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15060377
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, C: 0.31, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCCGTATTCCCCGGCGAGCTGGTGCAGGCCGGTGTAGGTGACACGCAGGGAGCCGCGGATCTCCGACAAGCGGTTCTCGAGCTCTGACATACGGTGCT[C/T]
GAGCCCCTGCCGTTGTCGCTCATTGCCAGCCACCAGCTCCTGCATCTTCTGGAGGTCCTCGCAAACCTCCGCTAAGTCGCGCGCCAGCCGGTCGGCGCGC

Reverse complement sequence

GCGCGCCGACCGGCTGGCGCGCGACTTAGCGGAGGTTTGCGAGGACCTCCAGAAGATGCAGGAGCTGGTGGCTGGCAATGAGCGACAACGGCAGGGGCTC[G/A]
AGCACCGTATGTCAGAGCTCGAGAACCGCTTGTCGGAGATCCGCGGCTCCCTGCGTGTCACCTACACCGGCCTGCACCAGCTCGCCGGGGAATACGGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.60% 24.70% 17.27% 9.48% NA
All Indica  2759 25.80% 31.50% 27.47% 15.26% NA
All Japonica  1512 81.00% 17.80% 0.60% 0.66% NA
Aus  269 87.70% 2.60% 7.06% 2.60% NA
Indica I  595 27.60% 8.90% 16.30% 47.23% NA
Indica II  465 24.90% 45.20% 25.59% 4.30% NA
Indica III  913 23.70% 37.30% 36.80% 2.19% NA
Indica Intermediate  786 27.50% 33.60% 26.21% 12.72% NA
Temperate Japonica  767 91.00% 8.30% 0.52% 0.13% NA
Tropical Japonica  504 68.80% 29.40% 0.40% 1.39% NA
Japonica Intermediate  241 74.30% 23.70% 1.24% 0.83% NA
VI/Aromatic  96 70.80% 0.00% 23.96% 5.21% NA
Intermediate  90 63.30% 23.30% 7.78% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215060377 C -> DEL LOC_Os12g25940.1 N frameshift_variant Average:39.005; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1215060377 C -> T LOC_Os12g25940.1 missense_variant ; p.Glu333Lys; MODERATE nonsynonymous_codon ; E333K Average:39.005; most accessible tissue: Minghui63 young leaf, score: 78.821 unknown unknown DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215060377 NA 1.35E-09 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 3.19E-09 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 2.32E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 7.82E-09 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 6.20E-07 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.12E-13 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 8.69E-07 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 4.39E-07 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 7.90E-09 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 9.43E-06 9.43E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 8.78E-07 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 3.54E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 1.95E-06 1.95E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 2.18E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.75E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.18E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 5.24E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.97E-08 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 7.49E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 7.14E-09 mr1830_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 6.04E-06 6.04E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.09E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.74E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 3.59E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 1.26E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 3.76E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215060377 NA 6.48E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251