Search for Variation information by Variation ID:
Detailed information for vg1215059534:
| Variant ID: vg1215059534 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15059534 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, T: 0.27, others allele: 0.00, population size: 59. )
Flanking Sequence (100 bp) in Reference Genome:
CAGCAACTCTTCAGATACGAGTTGAACCACACCTCACGACCCCGGAGTGTCTCTACGGCCTGGTCCTTTCTCACTTCCAGCATAGTCCTCTTGAGTTCCG[C/T]
GACCTCAAACTTCGTCCTCCAGTACTGGATGCGATGATCCTGGTCAGCAAGTGCACTCTCGAGATCTGCTCAGCATGGAAACGACTAAGTCAAGTTGCTC
Reverse complement sequence
GAGCAACTTGACTTAGTCGTTTCCATGCTGAGCAGATCTCGAGAGTGCACTTGCTGACCAGGATCATCGCATCCAGTACTGGAGGACGAAGTTTGAGGTC[G/A]
CGGAACTCAAGAGGACTATGCTGGAAGTGAGAAAGGACCAGGCCGTAGAGACACTCCGGGGTCGTGAGGTGTGGTTCAACTCGTATCTGAAGAGTTGCTG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 2.20% | 4.42% | 11.13% | NA |
| All Indica | 2759 | 83.50% | 2.10% | 4.71% | 9.68% | NA |
| All Japonica | 1512 | 77.60% | 2.20% | 3.84% | 16.34% | NA |
| Aus | 269 | 89.60% | 4.10% | 4.46% | 1.86% | NA |
| Indica I | 595 | 83.40% | 0.70% | 6.05% | 9.92% | NA |
| Indica II | 465 | 78.10% | 3.00% | 5.81% | 13.12% | NA |
| Indica III | 913 | 87.40% | 1.20% | 3.50% | 7.89% | NA |
| Indica Intermediate | 786 | 82.40% | 3.60% | 4.45% | 9.54% | NA |
| Temperate Japonica | 767 | 90.00% | 1.60% | 0.78% | 7.69% | NA |
| Tropical Japonica | 504 | 59.90% | 3.00% | 7.74% | 29.37% | NA |
| Japonica Intermediate | 241 | 75.50% | 2.50% | 5.39% | 16.60% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 83.30% | 2.20% | 8.89% | 5.56% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215059534 | C -> DEL | LOC_Os12g25940.1 | N | frameshift_variant | Average:15.598; most accessible tissue: Minghui63 young leaf, score: 23.613 | N | N | N | N |
| vg1215059534 | C -> T | LOC_Os12g25940.1 | missense_variant ; p.Ala451Thr; MODERATE | nonsynonymous_codon ; A451T | Average:15.598; most accessible tissue: Minghui63 young leaf, score: 23.613 | possibly damaging  |
1.571 |
TOLERATED | 0.06 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215059534 | 4.63E-07 | NA | mr1050 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 2.98E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 6.24E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 2.12E-07 | mr1088 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 2.12E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 5.56E-06 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 3.88E-07 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 1.33E-07 | mr1246 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 8.30E-08 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 4.14E-06 | mr1195_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215059534 | NA | 2.98E-06 | mr1246_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |