\
| Variant ID: vg1215018131 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 15018131 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )
TAACCTACCACCTACATCTAAAACCTGTGGAGCACGCAACAAACAAAGGCAATCCTTAACATAAACACTACATCTACATTATCTATTACTAATATAGCTA[G/T]
CCTGGTGCAAGAATTTCCTTCTTTATACAGCCTGAGTATTGGAGCACTTTATATAAAATATTAAGCGATGAAGCTGCAATGATGAGAATATATTTTACTT
AAGTAAAATATATTCTCATCATTGCAGCTTCATCGCTTAATATTTTATATAAAGTGCTCCAATACTCAGGCTGTATAAAGAAGGAAATTCTTGCACCAGG[C/A]
TAGCTATATTAGTAATAGATAATGTAGATGTAGTGTTTATGTTAAGGATTGCCTTTGTTTGTTGCGTGCTCCACAGGTTTTAGATGTAGGTGGTAGGTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.10% | 0.50% | 0.89% | 7.58% | NA |
| All Indica | 2759 | 87.00% | 0.00% | 0.51% | 12.50% | NA |
| All Japonica | 1512 | 96.10% | 1.50% | 1.85% | 0.60% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.70% | 0.00% | 1.68% | 39.66% | NA |
| Indica II | 465 | 96.10% | 0.00% | 0.00% | 3.87% | NA |
| Indica III | 913 | 99.10% | 0.00% | 0.11% | 0.77% | NA |
| Indica Intermediate | 786 | 88.90% | 0.00% | 0.38% | 10.69% | NA |
| Temperate Japonica | 767 | 93.70% | 2.90% | 3.26% | 0.13% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1215018131 | G -> DEL | N | N | silent_mutation | Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1215018131 | G -> T | LOC_Os12g25880.1 | downstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg1215018131 | G -> T | LOC_Os12g25880-LOC_Os12g25910 | intergenic_region ; MODIFIER | silent_mutation | Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1215018131 | 8.14E-07 | 8.14E-07 | mr1108_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215018131 | 5.51E-06 | 5.19E-06 | mr1110_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215018131 | 7.68E-07 | 1.34E-06 | mr1112_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215018131 | 1.63E-06 | 1.63E-06 | mr1234_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1215018131 | NA | 8.24E-06 | mr1457_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |