\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1215018131:

Variant ID: vg1215018131 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 15018131
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCTACCACCTACATCTAAAACCTGTGGAGCACGCAACAAACAAAGGCAATCCTTAACATAAACACTACATCTACATTATCTATTACTAATATAGCTA[G/T]
CCTGGTGCAAGAATTTCCTTCTTTATACAGCCTGAGTATTGGAGCACTTTATATAAAATATTAAGCGATGAAGCTGCAATGATGAGAATATATTTTACTT

Reverse complement sequence

AAGTAAAATATATTCTCATCATTGCAGCTTCATCGCTTAATATTTTATATAAAGTGCTCCAATACTCAGGCTGTATAAAGAAGGAAATTCTTGCACCAGG[C/A]
TAGCTATATTAGTAATAGATAATGTAGATGTAGTGTTTATGTTAAGGATTGCCTTTGTTTGTTGCGTGCTCCACAGGTTTTAGATGTAGGTGGTAGGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.10% 0.50% 0.89% 7.58% NA
All Indica  2759 87.00% 0.00% 0.51% 12.50% NA
All Japonica  1512 96.10% 1.50% 1.85% 0.60% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.70% 0.00% 1.68% 39.66% NA
Indica II  465 96.10% 0.00% 0.00% 3.87% NA
Indica III  913 99.10% 0.00% 0.11% 0.77% NA
Indica Intermediate  786 88.90% 0.00% 0.38% 10.69% NA
Temperate Japonica  767 93.70% 2.90% 3.26% 0.13% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 98.30% 0.00% 1.24% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1215018131 G -> DEL N N silent_mutation Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg1215018131 G -> T LOC_Os12g25880.1 downstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg1215018131 G -> T LOC_Os12g25880-LOC_Os12g25910 intergenic_region ; MODIFIER silent_mutation Average:33.451; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1215018131 8.14E-07 8.14E-07 mr1108_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215018131 5.51E-06 5.19E-06 mr1110_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215018131 7.68E-07 1.34E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215018131 1.63E-06 1.63E-06 mr1234_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1215018131 NA 8.24E-06 mr1457_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251