\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214995596:

Variant ID: vg1214995596 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14995596
Reference Allele: GAlternative Allele: A,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.08, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTGAACCTGTTAGGTAGAGGAACTTTGAACCATTCAGGATACGGCTGTCGATATAGGTTTCCAACATCTTTCGGCCTAAGCCCAAACTGCTCCTTC[G/A,T]
TGACATCTGCAATCAAATCGGCCCATGGTCGTTGTTAAGGTGTTCCTTGAGGTTGTTGTGGCATGGGCTCGAATTGGTTGTATTGAGGAACAAATTGGGG

Reverse complement sequence

CCCCAATTTGTTCCTCAATACAACCAATTCGAGCCCATGCCACAACAACCTCAAGGAACACCTTAACAACGACCATGGGCCGATTTGATTGCAGATGTCA[C/T,A]
GAAGGAGCAGTTTGGGCTTAGGCCGAAAGATGTTGGAAACCTATATCGACAGCCGTATCCTGAATGGTTCAAAGTTCCTCTACCTAACAGGTTCAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.60% 24.00% 4.76% 36.20% T: 0.44%
All Indica  2759 45.70% 3.00% 6.56% 44.69% T: 0.04%
All Japonica  1512 2.40% 67.10% 1.72% 28.70% T: 0.13%
Aus  269 79.90% 4.50% 4.46% 4.46% T: 6.69%
Indica I  595 64.40% 1.80% 4.54% 29.24% NA
Indica II  465 56.80% 3.40% 4.52% 35.27% NA
Indica III  913 22.30% 2.30% 8.98% 66.37% NA
Indica Intermediate  786 52.30% 4.30% 6.49% 36.77% T: 0.13%
Temperate Japonica  767 0.80% 88.10% 0.78% 10.30% NA
Tropical Japonica  504 3.00% 39.50% 3.17% 54.17% T: 0.20%
Japonica Intermediate  241 6.20% 57.70% 1.66% 34.02% T: 0.41%
VI/Aromatic  96 96.90% 1.00% 1.04% 1.04% NA
Intermediate  90 30.00% 30.00% 5.56% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214995596 G -> DEL N N silent_mutation Average:19.622; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg1214995596 G -> A LOC_Os12g25850.1 intron_variant ; MODIFIER silent_mutation Average:19.622; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg1214995596 G -> T LOC_Os12g25850.1 intron_variant ; MODIFIER silent_mutation Average:19.622; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214995596 NA 2.09E-35 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 7.74E-29 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 2.58E-06 6.36E-63 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 4.31E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 3.03E-07 4.53E-63 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 7.25E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 6.03E-52 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 8.95E-06 1.36E-63 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 1.74E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 6.52E-23 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 3.96E-06 4.33E-08 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 1.90E-06 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 2.32E-10 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 8.77E-72 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 7.19E-47 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 1.86E-54 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 1.69E-62 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 1.85E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 6.33E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995596 NA 2.31E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251