\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214995396:

Variant ID: vg1214995396 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14995396
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAGAAAATCAGCCCAATTGTTAATTGATCCATATGGTAAAGAAGAAAACCAAGTAAAGGCCGATCCAGCCAAAGACAACCGGAATAACCTAACCCTCA[T/A]
GGCATCCACAGCCAATGCTTCACCGCACTGAGCTAAAAATCGGCTAATGTGCTCATAAGTCGATGTACTATCTTGCCCTGAGAACTTTGAAAAATCTAGA

Reverse complement sequence

TCTAGATTTTTCAAAGTTCTCAGGGCAAGATAGTACATCGACTTATGAGCACATTAGCCGATTTTTAGCTCAGTGCGGTGAAGCATTGGCTGTGGATGCC[A/T]
TGAGGGTTAGGTTATTCCGGTTGTCTTTGGCTGGATCGGCCTTTACTTGGTTTTCTTCTTTACCATATGGATCAATTAACAATTGGGCTGATTTTCTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 24.00% 4.25% 13.86% NA
All Indica  2759 83.00% 2.90% 6.74% 7.32% NA
All Japonica  1512 4.40% 66.90% 0.60% 28.17% NA
Aus  269 90.30% 5.90% 0.37% 3.35% NA
Indica I  595 90.90% 1.20% 4.54% 3.36% NA
Indica II  465 80.00% 3.20% 6.24% 10.54% NA
Indica III  913 79.70% 2.10% 8.32% 9.86% NA
Indica Intermediate  786 82.70% 5.00% 6.87% 5.47% NA
Temperate Japonica  767 1.80% 88.30% 0.26% 9.65% NA
Tropical Japonica  504 6.30% 39.10% 1.19% 53.37% NA
Japonica Intermediate  241 8.30% 56.80% 0.41% 34.44% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 46.70% 28.90% 5.56% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214995396 T -> DEL N N silent_mutation Average:13.925; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1214995396 T -> A LOC_Os12g25850.1 intron_variant ; MODIFIER silent_mutation Average:13.925; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214995396 NA 1.98E-36 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.38E-30 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.21E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.99E-60 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 2.31E-34 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 8.88E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 2.84E-06 2.03E-48 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 8.51E-06 8.57E-63 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 5.43E-53 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 7.57E-06 1.24E-53 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 9.07E-62 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 5.29E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 1.58E-06 1.58E-06 mr1577 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 7.02E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 3.34E-06 3.34E-06 mr1587 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.78E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 5.84E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 5.15E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.12E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.37E-38 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.07E-73 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.70E-55 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 2.79E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 5.08E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.48E-07 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.24E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 8.01E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 1.68E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396 NA 3.12E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251