Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214995396:

Variant ID: vg1214995396 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14995396
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAGAAAATCAGCCCAATTGTTAATTGATCCATATGGTAAAGAAGAAAACCAAGTAAAGGCCGATCCAGCCAAAGACAACCGGAATAACCTAACCCTCA[T/A]
GGCATCCACAGCCAATGCTTCACCGCACTGAGCTAAAAATCGGCTAATGTGCTCATAAGTCGATGTACTATCTTGCCCTGAGAACTTTGAAAAATCTAGA

Reverse complement sequence

TCTAGATTTTTCAAAGTTCTCAGGGCAAGATAGTACATCGACTTATGAGCACATTAGCCGATTTTTAGCTCAGTGCGGTGAAGCATTGGCTGTGGATGCC[A/T]
TGAGGGTTAGGTTATTCCGGTTGTCTTTGGCTGGATCGGCCTTTACTTGGTTTTCTTCTTTACCATATGGATCAATTAACAATTGGGCTGATTTTCTAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.90%	24.00%	4.25%	13.86%	NA
All Indica	2759	83.00%	2.90%	6.74%	7.32%	NA
All Japonica	1512	4.40%	66.90%	0.60%	28.17%	NA
Aus	269	90.30%	5.90%	0.37%	3.35%	NA
Indica I	595	90.90%	1.20%	4.54%	3.36%	NA
Indica II	465	80.00%	3.20%	6.24%	10.54%	NA
Indica III	913	79.70%	2.10%	8.32%	9.86%	NA
Indica Intermediate	786	82.70%	5.00%	6.87%	5.47%	NA
Temperate Japonica	767	1.80%	88.30%	0.26%	9.65%	NA
Tropical Japonica	504	6.30%	39.10%	1.19%	53.37%	NA
Japonica Intermediate	241	8.30%	56.80%	0.41%	34.44%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	46.70%	28.90%	5.56%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214995396	T -> DEL	N	N	silent_mutation	Average:13.925; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N
vg1214995396	T -> A	LOC_Os12g25850.1	intron_variant ; MODIFIER	silent_mutation	Average:13.925; most accessible tissue: Zhenshan97 panicle, score: 28.447	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214995396	NA	1.98E-36	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.38E-30	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.21E-07	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.99E-60	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	2.31E-34	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	8.88E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	2.84E-06	2.03E-48	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	8.51E-06	8.57E-63	mr1142	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	5.43E-53	mr1390	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	7.57E-06	1.24E-53	mr1490	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	9.07E-62	mr1491	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	5.29E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	1.58E-06	1.58E-06	mr1577	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	7.02E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	3.34E-06	3.34E-06	mr1587	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.78E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	5.84E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	5.15E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.12E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.37E-38	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.07E-73	mr1023_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.70E-55	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	2.79E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	5.08E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.48E-07	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.24E-07	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	8.01E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	1.68E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995396	NA	3.12E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251