Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1214995135:

Variant ID: vg1214995135 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14995135
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAGGCTACCTTCTGTGTAAGGTGTGACAAGCTTTCAAAGTCTTCCGATGAGAACTTCTCCCTAATTGGAGGGATCATACCCTGAAAAGCCAAATCGGC[A/T]
AACTGGGCATCAGTCAAACTCAAGCTGTAACATTTATTTCTCATCTCCCTGAATCTCTGAACATACTCATGCATTGGCTCATCATGCTTTTGCTTGATTG

Reverse complement sequence

CAATCAAGCAAAAGCATGATGAGCCAATGCATGAGTATGTTCAGAGATTCAGGGAGATGAGAAATAAATGTTACAGCTTGAGTTTGACTGATGCCCAGTT[T/A]
GCCGATTTGGCTTTTCAGGGTATGATCCCTCCAATTAGGGAGAAGTTCTCATCGGAAGACTTTGAAAGCTTGTCACACCTTACACAGAAGGTAGCCTTGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 0.50% 3.85% 71.14% NA
All Indica  2759 3.70% 0.70% 5.07% 90.54% NA
All Japonica  1512 67.10% 0.00% 0.26% 32.67% NA
Aus  269 4.50% 1.90% 6.69% 86.99% NA
Indica I  595 3.40% 0.80% 5.71% 90.08% NA
Indica II  465 3.70% 0.00% 8.17% 88.17% NA
Indica III  913 2.80% 0.30% 2.41% 94.41% NA
Indica Intermediate  786 5.10% 1.30% 5.85% 87.79% NA
Temperate Japonica  767 88.40% 0.00% 0.00% 11.60% NA
Tropical Japonica  504 39.10% 0.00% 0.60% 60.32% NA
Japonica Intermediate  241 57.70% 0.00% 0.41% 41.91% NA
VI/Aromatic  96 0.00% 1.00% 11.46% 87.50% NA
Intermediate  90 32.20% 0.00% 10.00% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214995135 A -> DEL LOC_Os12g25850.1 N frameshift_variant Average:9.876; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg1214995135 A -> T LOC_Os12g25850.1 missense_variant ; p.Phe355Leu; MODERATE nonsynonymous_codon ; F355L Average:9.876; most accessible tissue: Zhenshan97 panicle, score: 20.424 unknown unknown TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214995135 NA 5.80E-48 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.58E-42 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.80E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.63E-33 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 4.79E-64 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 4.36E-42 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.34E-51 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.18E-65 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.85E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.38E-55 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.78E-07 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 8.24E-58 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 9.41E-69 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 3.75E-59 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.05E-69 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.65E-06 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 4.31E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.31E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.57E-43 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.22E-75 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.05E-55 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 4.81E-60 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.30E-73 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 9.39E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 8.79E-08 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 4.51E-66 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 3.13E-13 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.44E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 5.54E-75 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 6.64E-68 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 9.34E-14 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.85E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 5.52E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 8.52E-07 NA mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 2.71E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.88E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 3.97E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 1.31E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214995135 NA 7.59E-07 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251