Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214952929:

Variant ID: vg1214952929 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14952929
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTGTAAAACTTTTGGATCTGAAAACTTTATAAAAGTTTAACTCAGAATGACATAGACAAATCTATCATATATCCATTTCCATATCAATCATTAGTTTT[C/T]
CGGTTTGCTCTATATATGTGGTTTGTACTACATAGTTTTCATTCATTGTTGCTAGGGGGGAAGAGATTGAGCCAGAGTTCTCGGAGGCTTCCTAATCTGA

Reverse complement sequence

TCAGATTAGGAAGCCTCCGAGAACTCTGGCTCAATCTCTTCCCCCCTAGCAACAATGAATGAAAACTATGTAGTACAAACCACATATATAGAGCAAACCG[G/A]
AAAACTAATGATTGATATGGAAATGGATATATGATAGATTTGTCTATGTCATTCTGAGTTAAACTTTTATAAAGTTTTCAGATCCAAAAGTTTTACACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	32.30%	0.74%	16.86%	NA
All Indica	2759	36.50%	34.20%	1.09%	28.27%	NA
All Japonica	1512	81.00%	18.70%	0.07%	0.26%	NA
Aus	269	25.30%	74.00%	0.37%	0.37%	NA
Indica I	595	70.40%	9.70%	0.17%	19.66%	NA
Indica II	465	21.30%	47.10%	0.22%	31.40%	NA
Indica III	913	22.20%	39.80%	2.19%	35.82%	NA
Indica Intermediate	786	36.30%	38.50%	1.02%	24.17%	NA
Temperate Japonica	767	90.60%	9.00%	0.00%	0.39%	NA
Tropical Japonica	504	69.60%	30.40%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	24.90%	0.41%	0.41%	NA
VI/Aromatic	96	22.90%	67.70%	0.00%	9.38%	NA
Intermediate	90	52.20%	41.10%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214952929	C -> DEL	N	N	silent_mutation	Average:48.46; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1214952929	C -> T	LOC_Os12g25770-LOC_Os12g25790	intergenic_region ; MODIFIER	silent_mutation	Average:48.46; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214952929	NA	2.32E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.17E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	2.16E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	6.93E-06	6.93E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	6.43E-09	mr1603	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	2.36E-06	mr1603	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.60E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	1.33E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	6.00E-06	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	4.66E-06	4.66E-06	mr1407_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.84E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	8.43E-09	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	1.84E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	4.44E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	5.31E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	4.29E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	2.98E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.30E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	8.11E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	1.74E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.20E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	4.43E-06	4.42E-06	mr1869_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	5.89E-07	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	3.82E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	1.72E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929	NA	1.00E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251