\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214952929:

Variant ID: vg1214952929 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14952929
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.04, others allele: 0.00, population size: 177. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTGTAAAACTTTTGGATCTGAAAACTTTATAAAAGTTTAACTCAGAATGACATAGACAAATCTATCATATATCCATTTCCATATCAATCATTAGTTTT[C/T]
CGGTTTGCTCTATATATGTGGTTTGTACTACATAGTTTTCATTCATTGTTGCTAGGGGGGAAGAGATTGAGCCAGAGTTCTCGGAGGCTTCCTAATCTGA

Reverse complement sequence

TCAGATTAGGAAGCCTCCGAGAACTCTGGCTCAATCTCTTCCCCCCTAGCAACAATGAATGAAAACTATGTAGTACAAACCACATATATAGAGCAAACCG[G/A]
AAAACTAATGATTGATATGGAAATGGATATATGATAGATTTGTCTATGTCATTCTGAGTTAAACTTTTATAAAGTTTTCAGATCCAAAAGTTTTACACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 32.30% 0.74% 16.86% NA
All Indica  2759 36.50% 34.20% 1.09% 28.27% NA
All Japonica  1512 81.00% 18.70% 0.07% 0.26% NA
Aus  269 25.30% 74.00% 0.37% 0.37% NA
Indica I  595 70.40% 9.70% 0.17% 19.66% NA
Indica II  465 21.30% 47.10% 0.22% 31.40% NA
Indica III  913 22.20% 39.80% 2.19% 35.82% NA
Indica Intermediate  786 36.30% 38.50% 1.02% 24.17% NA
Temperate Japonica  767 90.60% 9.00% 0.00% 0.39% NA
Tropical Japonica  504 69.60% 30.40% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 24.90% 0.41% 0.41% NA
VI/Aromatic  96 22.90% 67.70% 0.00% 9.38% NA
Intermediate  90 52.20% 41.10% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214952929 C -> DEL N N silent_mutation Average:48.46; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1214952929 C -> T LOC_Os12g25770-LOC_Os12g25790 intergenic_region ; MODIFIER silent_mutation Average:48.46; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214952929 NA 2.32E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.17E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 2.16E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 6.93E-06 6.93E-06 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 6.43E-09 mr1603 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 2.36E-06 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.60E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 1.33E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 6.00E-06 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 4.66E-06 4.66E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.84E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 8.43E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 1.84E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 4.44E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 5.31E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 4.29E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 2.98E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.30E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 8.11E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 1.74E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.20E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 4.43E-06 4.42E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 5.89E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 3.82E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 1.72E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214952929 NA 1.00E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251