\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214943582:

Variant ID: vg1214943582 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14943582
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ACAGACTCTTTGGCTCGGGAGGGATCAGGAGGAAGCAGTGTAGCGGAAAATACCTGGAAAGTTGCAATATTTGGATTGACATATATCGGAATGTACTGTT[A/T]
GCACAAAATTTTTGTAGAGTGCTCTTTAGTGGCCATGGCATCTGAACTAAATGCCTGTCTGAATTGAGCAGTCTGTCTAAATGAAAGGGGAGAAGAACAA

Reverse complement sequence

TTGTTCTTCTCCCCTTTCATTTAGACAGACTGCTCAATTCAGACAGGCATTTAGTTCAGATGCCATGGCCACTAAAGAGCACTCTACAAAAATTTTGTGC[T/A]
AACAGTACATTCCGATATATGTCAATCCAAATATTGCAACTTTCCAGGTATTTTCCGCTACACTGCTTCCTCCTGATCCCTCCCGAGCCAAAGAGTCTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.50% 14.40% 0.72% 16.38% NA
All Indica  2759 47.60% 23.70% 1.20% 27.47% NA
All Japonica  1512 98.90% 0.90% 0.00% 0.26% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 27.10% 52.40% 1.18% 19.33% NA
Indica II  465 62.40% 6.70% 0.86% 30.11% NA
Indica III  913 49.80% 13.90% 1.10% 35.16% NA
Indica Intermediate  786 51.90% 23.40% 1.53% 23.16% NA
Temperate Japonica  767 99.30% 0.30% 0.00% 0.39% NA
Tropical Japonica  504 98.20% 1.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 2.10% 1.04% 8.33% NA
Intermediate  90 83.30% 13.30% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214943582 A -> DEL N N silent_mutation Average:50.506; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1214943582 A -> T LOC_Os12g25770.1 downstream_gene_variant ; 1608.0bp to feature; MODIFIER silent_mutation Average:50.506; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N
vg1214943582 A -> T LOC_Os12g25760-LOC_Os12g25770 intergenic_region ; MODIFIER silent_mutation Average:50.506; most accessible tissue: Minghui63 flag leaf, score: 65.44 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214943582 NA 5.05E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 4.78E-06 mr1186 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 2.76E-07 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 2.54E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 5.33E-06 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 2.46E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 1.64E-06 mr1164_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 9.62E-07 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 8.62E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 4.01E-06 NA mr1308_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 7.21E-07 4.43E-09 mr1308_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 7.77E-08 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 6.81E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 NA 3.50E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214943582 1.25E-06 1.25E-06 mr1853_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251