\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214931700:

Variant ID: vg1214931700 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14931700
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGCAAGTATTAGATCATAAATCGTTACCACTCGACGCGCTGTGCAGCGAAAGTAAGTGCTAAGTAGCCGAAGGAACGTTGTGGACGTAGCTCACGT[C/T]
GGTGTAGAGGAAGTAGTTGATCGCAACAGCTCGACATTCTCCTCCTCATGCGTTCTCCTCGCAGTGCTCCCACACCGATCAACACCGCAAACTAGCGGCA

Reverse complement sequence

TGCCGCTAGTTTGCGGTGTTGATCGGTGTGGGAGCACTGCGAGGAGAACGCATGAGGAGGAGAATGTCGAGCTGTTGCGATCAACTACTTCCTCTACACC[G/A]
ACGTGAGCTACGTCCACAACGTTCCTTCGGCTACTTAGCACTTACTTTCGCTGCACAGCGCGTCGAGTGGTAACGATTTATGATCTAATACTTGCATAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.30% 15.60% 0.11% 0.00% NA
All Indica  2759 93.40% 6.50% 0.07% 0.00% NA
All Japonica  1512 85.90% 14.00% 0.07% 0.00% NA
Aus  269 8.60% 90.70% 0.74% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 92.00% 7.90% 0.11% 0.00% NA
Indica Intermediate  786 93.10% 6.70% 0.13% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 70.60% 29.20% 0.20% 0.00% NA
Japonica Intermediate  241 83.00% 17.00% 0.00% 0.00% NA
VI/Aromatic  96 11.50% 88.50% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214931700 C -> T LOC_Os12g25734.1 upstream_gene_variant ; 4238.0bp to feature; MODIFIER silent_mutation Average:57.646; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1214931700 C -> T LOC_Os12g25750.1 downstream_gene_variant ; 1348.0bp to feature; MODIFIER silent_mutation Average:57.646; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1214931700 C -> T LOC_Os12g25760.1 downstream_gene_variant ; 1492.0bp to feature; MODIFIER silent_mutation Average:57.646; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N
vg1214931700 C -> T LOC_Os12g25750-LOC_Os12g25760 intergenic_region ; MODIFIER silent_mutation Average:57.646; most accessible tissue: Zhenshan97 young leaf, score: 80.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214931700 6.43E-15 1.02E-34 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.90E-09 2.91E-26 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 1.08E-06 mr1018 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 2.19E-12 1.69E-31 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 7.54E-08 3.05E-20 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 5.46E-12 4.29E-32 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 5.69E-08 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 7.14E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 3.68E-12 1.88E-29 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 4.33E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 3.43E-09 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.47E-10 2.02E-25 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.24E-08 1.10E-22 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 8.25E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 3.77E-12 1.65E-29 mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 1.12E-07 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 6.71E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 9.49E-06 mr1235 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 8.00E-06 NA mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 2.02E-09 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 8.44E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 6.19E-12 6.71E-30 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 4.71E-10 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 3.56E-09 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 1.51E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.67E-06 2.08E-06 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 2.35E-11 mr1489 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 3.27E-11 3.05E-27 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.12E-07 1.67E-21 mr1491 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 7.34E-13 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.46E-07 1.22E-17 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 4.75E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 7.72E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 1.19E-06 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 3.26E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 2.03E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 4.86E-06 mr1019_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 4.47E-16 2.47E-38 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 2.02E-09 2.31E-22 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 4.53E-18 1.03E-38 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.76E-13 1.19E-33 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 5.97E-08 mr1089_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 7.22E-09 mr1093_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 2.00E-13 5.16E-32 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.16E-16 4.59E-41 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 5.56E-09 mr1235_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 7.15E-06 mr1243_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.52E-17 2.09E-37 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 8.87E-06 3.70E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 1.93E-07 2.90E-15 mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 4.90E-14 9.73E-33 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 2.98E-09 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 4.84E-07 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214931700 NA 1.57E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251