\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214929592:

Variant ID: vg1214929592 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14929592
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGTGTCTCATGTTGGGTCTATCCAACAACATGTTCGCCAACATGTGTCCACATTATTAATTTAGTATCTCTATACCATGATCCATGAGACATGATCAT[C/T]
AATTAATACATGTGCTGATTATCTAAATATATTTGTTCCACATATGATATTTGATCAGGGATCCTTTAGAAATAACAGCATATAACATAAAGAGTCTCAT

Reverse complement sequence

ATGAGACTCTTTATGTTATATGCTGTTATTTCTAAAGGATCCCTGATCAAATATCATATGTGGAACAAATATATTTAGATAATCAGCACATGTATTAATT[G/A]
ATGATCATGTCTCATGGATCATGGTATAGAGATACTAAATTAATAATGTGGACACATGTTGGCGAACATGTTGTTGGATAGACCCAACATGAGACACTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.20% 0.60% 0.21% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 97.40% 2.00% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 94.90% 3.80% 1.30% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214929592 C -> T LOC_Os12g25734.1 upstream_gene_variant ; 2130.0bp to feature; MODIFIER silent_mutation Average:20.902; most accessible tissue: Minghui63 flower, score: 27.72 N N N N
vg1214929592 C -> T LOC_Os12g25750.1 upstream_gene_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:20.902; most accessible tissue: Minghui63 flower, score: 27.72 N N N N
vg1214929592 C -> T LOC_Os12g25760.1 downstream_gene_variant ; 3600.0bp to feature; MODIFIER silent_mutation Average:20.902; most accessible tissue: Minghui63 flower, score: 27.72 N N N N
vg1214929592 C -> T LOC_Os12g25734-LOC_Os12g25750 intergenic_region ; MODIFIER silent_mutation Average:20.902; most accessible tissue: Minghui63 flower, score: 27.72 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214929592 NA 4.15E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214929592 3.94E-06 2.20E-07 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214929592 NA 4.21E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214929592 1.80E-07 5.63E-07 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214929592 NA 2.28E-07 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214929592 NA 2.28E-06 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251