\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214885319:

Variant ID: vg1214885319 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14885319
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.18, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAGACCGCTCTTGGCGAGATGACACAAGCGACGGGAAGGGCTCTGCGAGGTTCACTGGCACGGGGGACGACGGCGGCTTGGGGGCATCGAGGCGCCA[C/T]
GCTCGGTCAGAGGCCACCTCAGCGTGCGCAAGCAGGAGGAGCGCTGGCACAAGGTGGCGCGCCGAGAGCGGTATTGCCCACCACTGCCACTCGCCCACCG

Reverse complement sequence

CGGTGGGCGAGTGGCAGTGGTGGGCAATACCGCTCTCGGCGCGCCACCTTGTGCCAGCGCTCCTCCTGCTTGCGCACGCTGAGGTGGCCTCTGACCGAGC[G/A]
TGGCGCCTCGATGCCCCCAAGCCGCCGTCGTCCCCCGTGCCAGTGAACCTCGCAGAGCCCTTCCCGTCGCTTGTGTCATCTCGCCAAGAGCGGTCTTGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.40% 42.50% 0.08% 0.00% NA
All Indica  2759 40.20% 59.70% 0.14% 0.00% NA
All Japonica  1512 98.20% 1.80% 0.00% 0.00% NA
Aus  269 14.50% 85.50% 0.00% 0.00% NA
Indica I  595 23.90% 76.00% 0.17% 0.00% NA
Indica II  465 57.60% 42.20% 0.22% 0.00% NA
Indica III  913 39.40% 60.50% 0.11% 0.00% NA
Indica Intermediate  786 43.10% 56.70% 0.13% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 78.10% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214885319 C -> T LOC_Os12g25680.1 synonymous_variant ; p.His279His; LOW synonymous_codon Average:90.961; most accessible tissue: Minghui63 flag leaf, score: 96.33 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214885319 C T -0.02 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214885319 NA 3.76E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1214885319 7.84E-06 NA mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214885319 NA 3.71E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214885319 5.87E-06 NA mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214885319 1.20E-06 NA mr1491 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214885319 NA 2.38E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214885319 NA 5.52E-07 mr1805_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251