\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214879927:

Variant ID: vg1214879927 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14879927
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TAAATTTTGGTATAGTTTTAAGAGTAAAAGATTTCAGAAGTACTAAATTTTGGCATCATATATAGCAATGGTTAATATGTGTTTTTGTTTGTTGCCCTAC[C/T,A]
AAAATTTGATAGTACCAGAATTTGGTAAGGTTAATTAATGAAAACATGATCATTGGGACTAATTAACCATGTTTGCTAAGTGCGGAAGGATTTCAATGCC

Reverse complement sequence

GGCATTGAAATCCTTCCGCACTTAGCAAACATGGTTAATTAGTCCCAATGATCATGTTTTCATTAATTAACCTTACCAAATTCTGGTACTATCAAATTTT[G/A,T]
GTAGGGCAACAAACAAAAACACATATTAACCATTGCTATATATGATGCCAAAATTTAGTACTTCTGAAATCTTTTACTCTTAAAACTATACCAAAATTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 32.70% 0.17% 0.00% A: 15.13%
All Indica  2759 40.50% 33.90% 0.29% 0.00% A: 25.26%
All Japonica  1512 81.30% 18.50% 0.00% 0.00% A: 0.20%
Aus  269 14.10% 85.50% 0.00% 0.00% A: 0.37%
Indica I  595 61.20% 21.80% 0.34% 0.00% A: 16.64%
Indica II  465 43.20% 42.40% 0.22% 0.00% A: 14.19%
Indica III  913 28.70% 32.50% 0.33% 0.00% A: 38.44%
Indica Intermediate  786 37.00% 39.70% 0.25% 0.00% A: 23.03%
Temperate Japonica  767 91.00% 8.60% 0.00% 0.00% A: 0.39%
Tropical Japonica  504 69.80% 30.20% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 65.60% 0.00% 0.00% A: 10.42%
Intermediate  90 55.60% 40.00% 0.00% 0.00% A: 4.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214879927 C -> A LOC_Os12g25680.1 upstream_gene_variant ; 3270.0bp to feature; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N
vg1214879927 C -> A LOC_Os12g25670.1 downstream_gene_variant ; 4928.0bp to feature; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N
vg1214879927 C -> A LOC_Os12g25670-LOC_Os12g25680 intergenic_region ; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N
vg1214879927 C -> T LOC_Os12g25680.1 upstream_gene_variant ; 3270.0bp to feature; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N
vg1214879927 C -> T LOC_Os12g25670.1 downstream_gene_variant ; 4928.0bp to feature; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N
vg1214879927 C -> T LOC_Os12g25670-LOC_Os12g25680 intergenic_region ; MODIFIER silent_mutation Average:47.266; most accessible tissue: Callus, score: 90.325 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214879927 NA 2.32E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.17E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 2.16E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 4.72E-06 mr1186 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 6.93E-06 6.93E-06 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 4.41E-07 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.68E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.69E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 8.27E-07 NA mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 4.12E-06 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 4.53E-06 NA mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 1.76E-06 NA mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 5.15E-06 NA mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 8.26E-06 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.60E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.33E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 1.12E-08 NA mr1390_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 1.95E-07 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 4.66E-06 4.66E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.84E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 8.43E-09 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 7.21E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 7.18E-08 NA mr1490_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 1.92E-06 NA mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.36E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 9.76E-06 mr1520_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.84E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 4.44E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 5.31E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 5.28E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 4.29E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 2.98E-07 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.30E-06 mr1623_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 8.11E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.74E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.01E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.20E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 4.43E-06 4.42E-06 mr1869_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 5.89E-07 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 3.82E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.72E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927 NA 1.00E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251