Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214879927:

Variant ID: vg1214879927 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14879927
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.23, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TAAATTTTGGTATAGTTTTAAGAGTAAAAGATTTCAGAAGTACTAAATTTTGGCATCATATATAGCAATGGTTAATATGTGTTTTTGTTTGTTGCCCTAC[C/T,A]
AAAATTTGATAGTACCAGAATTTGGTAAGGTTAATTAATGAAAACATGATCATTGGGACTAATTAACCATGTTTGCTAAGTGCGGAAGGATTTCAATGCC

Reverse complement sequence

GGCATTGAAATCCTTCCGCACTTAGCAAACATGGTTAATTAGTCCCAATGATCATGTTTTCATTAATTAACCTTACCAAATTCTGGTACTATCAAATTTT[G/A,T]
GTAGGGCAACAAACAAAAACACATATTAACCATTGCTATATATGATGCCAAAATTTAGTACTTCTGAAATCTTTTACTCTTAAAACTATACCAAAATTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	32.70%	0.17%	0.00%	A: 15.13%
All Indica	2759	40.50%	33.90%	0.29%	0.00%	A: 25.26%
All Japonica	1512	81.30%	18.50%	0.00%	0.00%	A: 0.20%
Aus	269	14.10%	85.50%	0.00%	0.00%	A: 0.37%
Indica I	595	61.20%	21.80%	0.34%	0.00%	A: 16.64%
Indica II	465	43.20%	42.40%	0.22%	0.00%	A: 14.19%
Indica III	913	28.70%	32.50%	0.33%	0.00%	A: 38.44%
Indica Intermediate	786	37.00%	39.70%	0.25%	0.00%	A: 23.03%
Temperate Japonica	767	91.00%	8.60%	0.00%	0.00%	A: 0.39%
Tropical Japonica	504	69.80%	30.20%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	25.70%	0.00%	0.00%	NA
VI/Aromatic	96	24.00%	65.60%	0.00%	0.00%	A: 10.42%
Intermediate	90	55.60%	40.00%	0.00%	0.00%	A: 4.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214879927	C -> A	LOC_Os12g25680.1	upstream_gene_variant ; 3270.0bp to feature; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N
vg1214879927	C -> A	LOC_Os12g25670.1	downstream_gene_variant ; 4928.0bp to feature; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N
vg1214879927	C -> A	LOC_Os12g25670-LOC_Os12g25680	intergenic_region ; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N
vg1214879927	C -> T	LOC_Os12g25680.1	upstream_gene_variant ; 3270.0bp to feature; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N
vg1214879927	C -> T	LOC_Os12g25670.1	downstream_gene_variant ; 4928.0bp to feature; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N
vg1214879927	C -> T	LOC_Os12g25670-LOC_Os12g25680	intergenic_region ; MODIFIER	silent_mutation	Average:47.266; most accessible tissue: Callus, score: 90.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214879927	NA	2.32E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.17E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	2.16E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	4.72E-06	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	6.93E-06	6.93E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	4.41E-07	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.68E-08	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.69E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	8.27E-07	NA	mr1022_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	4.12E-06	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	4.53E-06	NA	mr1055_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	1.76E-06	NA	mr1079_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	5.15E-06	NA	mr1079_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	8.26E-06	NA	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.60E-06	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.33E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	1.12E-08	NA	mr1390_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	1.95E-07	NA	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	4.66E-06	4.66E-06	mr1407_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.84E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	8.43E-09	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	7.21E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	7.18E-08	NA	mr1490_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	1.92E-06	NA	mr1490_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.36E-11	mr1520_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	9.76E-06	mr1520_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.84E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	4.44E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	5.31E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	5.28E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	4.29E-06	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	2.98E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.30E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	8.11E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.74E-07	mr1696_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.01E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.20E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	4.43E-06	4.42E-06	mr1869_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	5.89E-07	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	3.82E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.72E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214879927	NA	1.00E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251