Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214837584:

Variant ID: vg1214837584 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14837584
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

TCATCTATCGCTGGCAGTCACCTCGCAGCATTGTTTCCATGGAAACAAGCTAGGTCGCATGTCGTTTCCGTCATCAGCTCATGTACCACGCGCGCTACTT[G/T]
AGTTGTACATGAGCTGATGAAATATATGCAAAGTGTAGCGCGGTACATGAGCTGTATGCTCTGTGACCCGATGGACGCAGCCGTTCGGTGTCGATGAGTC

Reverse complement sequence

GACTCATCGACACCGAACGGCTGCGTCCATCGGGTCACAGAGCATACAGCTCATGTACCGCGCTACACTTTGCATATATTTCATCAGCTCATGTACAACT[C/A]
AAGTAGCGCGCGTGGTACATGAGCTGATGACGGAAACGACATGCGACCTAGCTTGTTTCCATGGAAACAATGCTGCGAGGTGACTGCCAGCGATAGATGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	31.40%	0.23%	0.30%	NA
All Indica	2759	53.80%	45.50%	0.29%	0.47%	NA
All Japonica	1512	86.80%	13.10%	0.07%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	76.30%	23.20%	0.34%	0.17%	NA
Indica II	465	34.40%	63.90%	0.43%	1.29%	NA
Indica III	913	51.40%	48.00%	0.11%	0.55%	NA
Indica Intermediate	786	50.90%	48.60%	0.38%	0.13%	NA
Temperate Japonica	767	93.90%	6.10%	0.00%	0.00%	NA
Tropical Japonica	504	78.40%	21.60%	0.00%	0.00%	NA
Japonica Intermediate	241	82.20%	17.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	68.90%	27.80%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214837584	G -> DEL	N	N	silent_mutation	Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493	N	N	N	N
vg1214837584	G -> T	LOC_Os12g25640.1	downstream_gene_variant ; 935.0bp to feature; MODIFIER	silent_mutation	Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493	N	N	N	N
vg1214837584	G -> T	LOC_Os12g25630-LOC_Os12g25640	intergenic_region ; MODIFIER	silent_mutation	Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1214837584	G	T	0.24	0.17	0.19	0.2	0.33	0.28

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214837584	9.16E-07	6.17E-08	mr1188	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	3.63E-06	3.63E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	4.73E-07	4.73E-07	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	2.46E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	1.40E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	2.76E-06	mr1603	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	1.43E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	7.83E-07	2.61E-09	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	1.11E-06	mr1603_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	4.14E-07	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	2.42E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	7.80E-07	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	1.48E-06	mr1780_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584	NA	1.47E-06	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251