\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214837584:

Variant ID: vg1214837584 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14837584
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCTATCGCTGGCAGTCACCTCGCAGCATTGTTTCCATGGAAACAAGCTAGGTCGCATGTCGTTTCCGTCATCAGCTCATGTACCACGCGCGCTACTT[G/T]
AGTTGTACATGAGCTGATGAAATATATGCAAAGTGTAGCGCGGTACATGAGCTGTATGCTCTGTGACCCGATGGACGCAGCCGTTCGGTGTCGATGAGTC

Reverse complement sequence

GACTCATCGACACCGAACGGCTGCGTCCATCGGGTCACAGAGCATACAGCTCATGTACCGCGCTACACTTTGCATATATTTCATCAGCTCATGTACAACT[C/A]
AAGTAGCGCGCGTGGTACATGAGCTGATGACGGAAACGACATGCGACCTAGCTTGTTTCCATGGAAACAATGCTGCGAGGTGACTGCCAGCGATAGATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.40% 0.23% 0.30% NA
All Indica  2759 53.80% 45.50% 0.29% 0.47% NA
All Japonica  1512 86.80% 13.10% 0.07% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 76.30% 23.20% 0.34% 0.17% NA
Indica II  465 34.40% 63.90% 0.43% 1.29% NA
Indica III  913 51.40% 48.00% 0.11% 0.55% NA
Indica Intermediate  786 50.90% 48.60% 0.38% 0.13% NA
Temperate Japonica  767 93.90% 6.10% 0.00% 0.00% NA
Tropical Japonica  504 78.40% 21.60% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 68.90% 27.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214837584 G -> DEL N N silent_mutation Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg1214837584 G -> T LOC_Os12g25640.1 downstream_gene_variant ; 935.0bp to feature; MODIFIER silent_mutation Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N
vg1214837584 G -> T LOC_Os12g25630-LOC_Os12g25640 intergenic_region ; MODIFIER silent_mutation Average:89.881; most accessible tissue: Zhenshan97 panicle, score: 95.493 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214837584 G T 0.24 0.17 0.19 0.2 0.33 0.28

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214837584 9.16E-07 6.17E-08 mr1188 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 3.63E-06 3.63E-06 mr1325 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 4.73E-07 4.73E-07 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 2.46E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 1.40E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 2.76E-06 mr1603 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 1.43E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 7.83E-07 2.61E-09 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 1.11E-06 mr1603_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 4.14E-07 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 2.42E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 7.80E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 1.48E-06 mr1780_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214837584 NA 1.47E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251