Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214824840:

Variant ID: vg1214824840 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14824840
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTTCAGCCCAATTTCAGACAAGTTTCAACAATTAATAGAGTACTAGATTTAAAGCAAGTTTAGACTTGTAGGTGAGTTTGATTTATCTATTTGGTGAT[A/G]
ACGCGGGTTATCTGACCATGGATTAGATCAAGTCAAATTTAAGACGGTAGATGGAGTTGAACATAGTCTTCGGGAAGTGTATGATGTGACAGCTAGGAAG

Reverse complement sequence

CTTCCTAGCTGTCACATCATACACTTCCCGAAGACTATGTTCAACTCCATCTACCGTCTTAAATTTGACTTGATCTAATCCATGGTCAGATAACCCGCGT[T/C]
ATCACCAAATAGATAAATCAAACTCACCTACAAGTCTAAACTTGCTTTAAATCTAGTACTCTATTAATTGTTGAAACTTGTCTGAAATTGGGCTGAACTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	29.10%	2.64%	2.48%	NA
All Indica	2759	84.40%	7.10%	4.31%	4.17%	NA
All Japonica	1512	24.90%	75.10%	0.00%	0.00%	NA
Aus	269	94.40%	5.20%	0.37%	0.00%	NA
Indica I	595	92.80%	6.10%	1.01%	0.17%	NA
Indica II	465	92.70%	4.50%	1.94%	0.86%	NA
Indica III	913	77.00%	8.40%	6.46%	8.11%	NA
Indica Intermediate	786	81.80%	7.90%	5.73%	4.58%	NA
Temperate Japonica	767	10.30%	89.70%	0.00%	0.00%	NA
Tropical Japonica	504	41.70%	58.30%	0.00%	0.00%	NA
Japonica Intermediate	241	36.10%	63.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	60.00%	32.20%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214824840	A -> DEL	N	N	silent_mutation	Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1214824840	A -> G	LOC_Os12g25610.1	upstream_gene_variant ; 1602.0bp to feature; MODIFIER	silent_mutation	Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1214824840	A -> G	LOC_Os12g25630.1	downstream_gene_variant ; 2472.0bp to feature; MODIFIER	silent_mutation	Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N
vg1214824840	A -> G	LOC_Os12g25610-LOC_Os12g25630	intergenic_region ; MODIFIER	silent_mutation	Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214824840	5.70E-07	NA	mr1055	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	8.04E-06	NA	mr1178	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	1.14E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	7.31E-18	mr1529	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	9.36E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	4.63E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.23E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	1.23E-11	mr1667	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	9.41E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	8.82E-09	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	1.47E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.80E-13	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	4.54E-07	5.54E-40	mr1022_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	1.86E-07	NA	mr1022_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	6.05E-08	2.27E-12	mr1055_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.45E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	2.05E-07	NA	mr1178_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.57E-06	mr1195_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	2.72E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	4.41E-07	NA	mr1390_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.94E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	1.10E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	7.42E-12	mr1636_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	1.05E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.81E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840	NA	3.39E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251