\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214824840:

Variant ID: vg1214824840 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14824840
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.12, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTCAGCCCAATTTCAGACAAGTTTCAACAATTAATAGAGTACTAGATTTAAAGCAAGTTTAGACTTGTAGGTGAGTTTGATTTATCTATTTGGTGAT[A/G]
ACGCGGGTTATCTGACCATGGATTAGATCAAGTCAAATTTAAGACGGTAGATGGAGTTGAACATAGTCTTCGGGAAGTGTATGATGTGACAGCTAGGAAG

Reverse complement sequence

CTTCCTAGCTGTCACATCATACACTTCCCGAAGACTATGTTCAACTCCATCTACCGTCTTAAATTTGACTTGATCTAATCCATGGTCAGATAACCCGCGT[T/C]
ATCACCAAATAGATAAATCAAACTCACCTACAAGTCTAAACTTGCTTTAAATCTAGTACTCTATTAATTGTTGAAACTTGTCTGAAATTGGGCTGAACTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 29.10% 2.64% 2.48% NA
All Indica  2759 84.40% 7.10% 4.31% 4.17% NA
All Japonica  1512 24.90% 75.10% 0.00% 0.00% NA
Aus  269 94.40% 5.20% 0.37% 0.00% NA
Indica I  595 92.80% 6.10% 1.01% 0.17% NA
Indica II  465 92.70% 4.50% 1.94% 0.86% NA
Indica III  913 77.00% 8.40% 6.46% 8.11% NA
Indica Intermediate  786 81.80% 7.90% 5.73% 4.58% NA
Temperate Japonica  767 10.30% 89.70% 0.00% 0.00% NA
Tropical Japonica  504 41.70% 58.30% 0.00% 0.00% NA
Japonica Intermediate  241 36.10% 63.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 60.00% 32.20% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214824840 A -> DEL N N silent_mutation Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1214824840 A -> G LOC_Os12g25610.1 upstream_gene_variant ; 1602.0bp to feature; MODIFIER silent_mutation Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1214824840 A -> G LOC_Os12g25630.1 downstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N
vg1214824840 A -> G LOC_Os12g25610-LOC_Os12g25630 intergenic_region ; MODIFIER silent_mutation Average:69.258; most accessible tissue: Minghui63 flag leaf, score: 84.608 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214824840 5.70E-07 NA mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 8.04E-06 NA mr1178 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 1.14E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 7.31E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 9.36E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 4.63E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.23E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 1.23E-11 mr1667 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 9.41E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 8.82E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 1.47E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.80E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 4.54E-07 5.54E-40 mr1022_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 1.86E-07 NA mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 6.05E-08 2.27E-12 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.45E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 2.05E-07 NA mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.57E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 2.72E-10 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 4.41E-07 NA mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.94E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 1.10E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 7.42E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 1.05E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.81E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214824840 NA 3.39E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251