Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214823650:

Variant ID: vg1214823650 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14823650
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATCCGAATTTTCCTGCAGCAAAACAAAACTGCAAAAGAAGGCTGCATCTGTGTAAGGGTGAGGAGTCAATTCTGCCCTGCTAGGCAAGGCGAGCAAGC[A/G]
AGCGCGTGTTCCCCCTCTTCTCTCCACCACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCTCTCCTAGAATAAGCAAAGTG

Reverse complement sequence

CACTTTGCTTATTCTAGGAGAGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTGGTGGAGAGAAGAGGGGGAACACGCGCT[T/C]
GCTTGCTCGCCTTGCCTAGCAGGGCAGAATTGACTCCTCACCCTTACACAGATGCAGCCTTCTTTTGCAGTTTTGTTTTGCTGCAGGAAAATTCGGATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 25.80% 1.18% 5.52% NA
All Indica  2759 53.00% 36.00% 1.85% 9.13% NA
All Japonica  1512 86.60% 13.20% 0.20% 0.07% NA
Aus  269 96.70% 2.20% 0.37% 0.74% NA
Indica I  595 72.60% 22.40% 4.37% 0.67% NA
Indica II  465 24.70% 72.00% 0.43% 2.80% NA
Indica III  913 55.80% 25.60% 1.53% 17.09% NA
Indica Intermediate  786 51.80% 37.00% 1.15% 10.05% NA
Temperate Japonica  767 93.50% 6.40% 0.13% 0.00% NA
Tropical Japonica  504 78.20% 21.60% 0.00% 0.20% NA
Japonica Intermediate  241 82.20% 17.00% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 21.10% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214823650 A -> DEL N N silent_mutation Average:77.345; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1214823650 A -> G LOC_Os12g25600.1 upstream_gene_variant ; 3853.0bp to feature; MODIFIER silent_mutation Average:77.345; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1214823650 A -> G LOC_Os12g25610.1 upstream_gene_variant ; 412.0bp to feature; MODIFIER silent_mutation Average:77.345; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1214823650 A -> G LOC_Os12g25630.1 downstream_gene_variant ; 3662.0bp to feature; MODIFIER silent_mutation Average:77.345; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1214823650 A -> G LOC_Os12g25610-LOC_Os12g25630 intergenic_region ; MODIFIER silent_mutation Average:77.345; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214823650 A G -0.03 -0.01 -0.01 -0.03 -0.04 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214823650 NA 2.31E-09 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 1.10E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 7.49E-11 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 1.21E-08 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 8.62E-06 8.62E-06 mr1326_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 7.81E-06 7.80E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 9.88E-06 9.88E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 7.77E-10 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 9.67E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 2.41E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 3.56E-08 4.14E-10 mr1653_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 6.45E-08 2.88E-06 mr1668_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 2.14E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 5.66E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 2.70E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214823650 NA 4.94E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251