Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214815608:

Variant ID: vg1214815608 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14815608
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

GATCTGACCTCTATAGATTATCTTCAAACATATCACTTGTTCCATAACTGGGAATGGCTCTCACGAACAAGCAGCTCGGATTCACTTTCCTTACATTTAG[T/C]
TTACTTCCCACTATTCTCTTTATGTTGTTATCATTTAGCATTCAACGTATTCCTTTACACCTTCAGCCTTGATGTGTTCTTTCTCGATGGATCGATTGCT

Reverse complement sequence

AGCAATCGATCCATCGAGAAAGAACACATCAAGGCTGAAGGTGTAAAGGAATACGTTGAATGCTAAATGATAACAACATAAAGAGAATAGTGGGAAGTAA[A/G]
CTAAATGTAAGGAAAGTGAATCCGAGCTGCTTGTTCGTGAGAGCCATTCCCAGTTATGGAACAAGTGATATGTTTGAAGATAATCTATAGAGGTCAGATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	77.70%	2.30%	16.86%	3.11%	NA
All Indica	2759	71.80%	3.70%	20.51%	3.91%	NA
All Japonica	1512	96.70%	0.00%	3.17%	0.13%	NA
Aus	269	43.90%	0.40%	43.87%	11.90%	NA
Indica I	595	62.70%	1.50%	30.76%	5.04%	NA
Indica II	465	91.00%	0.20%	8.82%	0.00%	NA
Indica III	913	64.40%	6.50%	23.44%	5.70%	NA
Indica Intermediate	786	76.10%	4.30%	16.28%	3.31%	NA
Temperate Japonica	767	99.00%	0.00%	1.04%	0.00%	NA
Tropical Japonica	504	94.40%	0.00%	5.36%	0.20%	NA
Japonica Intermediate	241	94.20%	0.00%	5.39%	0.41%	NA
VI/Aromatic	96	39.60%	2.10%	54.17%	4.17%	NA
Intermediate	90	82.20%	2.20%	14.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214815608	T -> C	LOC_Os12g25590.1	upstream_gene_variant ; 3044.0bp to feature; MODIFIER	silent_mutation	Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1214815608	T -> C	LOC_Os12g25600.1	downstream_gene_variant ; 1446.0bp to feature; MODIFIER	silent_mutation	Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1214815608	T -> C	LOC_Os12g25590-LOC_Os12g25600	intergenic_region ; MODIFIER	silent_mutation	Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg1214815608	T -> DEL	N	N	silent_mutation	Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214815608	NA	1.96E-07	mr1308	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.54E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	3.99E-06	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.00E-06	mr1607	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	9.71E-08	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	4.61E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	2.64E-06	mr1898	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.88E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	6.94E-08	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	7.37E-07	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	5.12E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	3.43E-06	mr1272_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	8.68E-07	mr1308_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	2.15E-06	mr1354_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	2.16E-06	2.16E-06	mr1356_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	3.41E-06	3.41E-06	mr1356_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	9.48E-07	mr1361_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	3.43E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.15E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	6.17E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	6.37E-06	mr1603_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.40E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	2.45E-06	mr1607_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	4.45E-08	mr1629_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	4.23E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	1.99E-06	mr1887_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608	NA	4.99E-07	mr1887_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251