\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214815608:

Variant ID: vg1214815608 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14815608
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTGACCTCTATAGATTATCTTCAAACATATCACTTGTTCCATAACTGGGAATGGCTCTCACGAACAAGCAGCTCGGATTCACTTTCCTTACATTTAG[T/C]
TTACTTCCCACTATTCTCTTTATGTTGTTATCATTTAGCATTCAACGTATTCCTTTACACCTTCAGCCTTGATGTGTTCTTTCTCGATGGATCGATTGCT

Reverse complement sequence

AGCAATCGATCCATCGAGAAAGAACACATCAAGGCTGAAGGTGTAAAGGAATACGTTGAATGCTAAATGATAACAACATAAAGAGAATAGTGGGAAGTAA[A/G]
CTAAATGTAAGGAAAGTGAATCCGAGCTGCTTGTTCGTGAGAGCCATTCCCAGTTATGGAACAAGTGATATGTTTGAAGATAATCTATAGAGGTCAGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.70% 2.30% 16.86% 3.11% NA
All Indica  2759 71.80% 3.70% 20.51% 3.91% NA
All Japonica  1512 96.70% 0.00% 3.17% 0.13% NA
Aus  269 43.90% 0.40% 43.87% 11.90% NA
Indica I  595 62.70% 1.50% 30.76% 5.04% NA
Indica II  465 91.00% 0.20% 8.82% 0.00% NA
Indica III  913 64.40% 6.50% 23.44% 5.70% NA
Indica Intermediate  786 76.10% 4.30% 16.28% 3.31% NA
Temperate Japonica  767 99.00% 0.00% 1.04% 0.00% NA
Tropical Japonica  504 94.40% 0.00% 5.36% 0.20% NA
Japonica Intermediate  241 94.20% 0.00% 5.39% 0.41% NA
VI/Aromatic  96 39.60% 2.10% 54.17% 4.17% NA
Intermediate  90 82.20% 2.20% 14.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214815608 T -> C LOC_Os12g25590.1 upstream_gene_variant ; 3044.0bp to feature; MODIFIER silent_mutation Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1214815608 T -> C LOC_Os12g25600.1 downstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1214815608 T -> C LOC_Os12g25590-LOC_Os12g25600 intergenic_region ; MODIFIER silent_mutation Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1214815608 T -> DEL N N silent_mutation Average:11.95; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214815608 NA 1.96E-07 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.54E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 3.99E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.00E-06 mr1607 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 9.71E-08 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 4.61E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 2.64E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.88E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 6.94E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 7.37E-07 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 5.12E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 3.43E-06 mr1272_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 8.68E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 2.15E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 2.16E-06 2.16E-06 mr1356_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 3.41E-06 3.41E-06 mr1356_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 9.48E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 3.43E-06 mr1388_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.15E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 6.17E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 6.37E-06 mr1603_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.40E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 2.45E-06 mr1607_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 4.45E-08 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 4.23E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 1.99E-06 mr1887_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214815608 NA 4.99E-07 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251