RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1214801425:

Variant ID: vg1214801425 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14801425
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCAATATTTTGTTCTAGGGACACATGTTTTAAAGTAAGCAGCCGAAATTCCTTCATCAATTCTTGGCACTTCTCATTATAAACCATTAATATCATTCTT[G/A]
CATTCATATTCTCCTGCCAATTGATTGATTACCAGCAAAGAATCCCCCATGATTTCAATAGCATTGGCTTCAACTTCCTTGAGTAATCGCAACCCTTTAA

Reverse complement sequence

TTAAAGGGTTGCGATTACTCAAGGAAGTTGAAGCCAATGCTATTGAAATCATGGGGGATTCTTTGCTGGTAATCAATCAATTGGCAGGAGAATATGAATG[C/T]
AAGAATGATATTAATGGTTTATAATGAGAAGTGCCAAGAATTGATGAAGGAATTTCGGCTGCTTACTTTAAAACATGTGTCCCTAGAACAAAATATTGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	0.10%	30.15%	26.24%	NA
All Indica	2759	33.00%	0.20%	43.13%	23.67%	NA
All Japonica	1512	68.60%	0.00%	2.18%	29.23%	NA
Aus	269	19.30%	0.00%	60.59%	20.07%	NA
Indica I	595	36.00%	0.20%	36.81%	27.06%	NA
Indica II	465	36.10%	0.20%	43.23%	20.43%	NA
Indica III	913	27.70%	0.20%	46.11%	25.96%	NA
Indica Intermediate	786	35.00%	0.30%	44.40%	20.36%	NA
Temperate Japonica	767	89.20%	0.00%	1.17%	9.65%	NA
Tropical Japonica	504	42.30%	0.00%	3.37%	54.37%	NA
Japonica Intermediate	241	58.10%	0.00%	2.90%	39.00%	NA
VI/Aromatic	96	13.50%	0.00%	19.79%	66.67%	NA
Intermediate	90	47.80%	0.00%	22.22%	30.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214801425	G -> DEL	N	N	silent_mutation	Average:10.428; most accessible tissue: Callus, score: 43.476	N	N	N	N
vg1214801425	G -> A	LOC_Os12g25570.1	downstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:10.428; most accessible tissue: Callus, score: 43.476	N	N	N	N
vg1214801425	G -> A	LOC_Os12g25580.1	intron_variant ; MODIFIER	silent_mutation	Average:10.428; most accessible tissue: Callus, score: 43.476	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214801425	NA	1.29E-08	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	5.59E-36	mr1017	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	2.56E-30	mr1022	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	8.96E-61	mr1023	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	6.66E-35	mr1055	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	4.90E-47	mr1079	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	1.81E-06	1.82E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	2.42E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	8.68E-08	mr1088	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214801425	NA	7.99E-08	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 37 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1214801425:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact