\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214800053:

Variant ID: vg1214800053 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14800053
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCATCTCAAGATGACGAAAACTCATCGGCTATTATGTATCGGCAACATCAGCCAATCATGCATTAACCCAAACACTTGGGTAATATTTCTTCAAGTATTC[A/G]
CCATTTAGTGCTCTGCCATAAACTTCTCCATCGAGTCCTTGCAACATGTAAGCTCCTTTAGACACAATTTGAAACGGTCCTTCCCAATTCGACGACCACT

Reverse complement sequence

AGTGGTCGTCGAATTGGGAAGGACCGTTTCAAATTGTGTCTAAAGGAGCTTACATGTTGCAAGGACTCGATGGAGAAGTTTATGGCAGAGCACTAAATGG[T/C]
GAATACTTGAAGAAATATTACCCAAGTGTTTGGGTTAATGCATGATTGGCTGATGTTGCCGATACATAATAGCCGATGAGTTTTCGTCATCTTGAGATGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.20% 0.60% 32.33% 39.86% NA
All Indica  2759 7.60% 0.80% 45.85% 45.67% NA
All Japonica  1512 67.70% 0.00% 2.71% 29.63% NA
Aus  269 7.10% 1.90% 63.94% 27.14% NA
Indica I  595 13.30% 0.30% 35.13% 51.26% NA
Indica II  465 6.90% 0.40% 56.34% 36.34% NA
Indica III  913 3.20% 1.20% 44.91% 50.71% NA
Indica Intermediate  786 9.00% 1.00% 48.85% 41.09% NA
Temperate Japonica  767 88.50% 0.00% 2.74% 8.74% NA
Tropical Japonica  504 40.70% 0.00% 2.18% 57.14% NA
Japonica Intermediate  241 57.70% 0.00% 3.73% 38.59% NA
VI/Aromatic  96 2.10% 0.00% 25.00% 72.92% NA
Intermediate  90 34.40% 0.00% 28.89% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214800053 A -> DEL LOC_Os12g25580.1 N frameshift_variant Average:10.721; most accessible tissue: Callus, score: 43.444 N N N N
vg1214800053 A -> G LOC_Os12g25580.1 synonymous_variant ; p.Gly828Gly; LOW synonymous_codon Average:10.721; most accessible tissue: Callus, score: 43.444 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214800053 NA 4.59E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.40E-46 mr1016 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 5.69E-39 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.62E-71 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 3.62E-06 3.92E-33 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.85E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 9.59E-06 9.55E-68 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.58E-37 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 3.47E-07 3.03E-53 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.70E-06 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.50E-68 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 2.50E-07 1.32E-72 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.84E-56 mr1178 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 1.08E-06 NA mr1317 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 5.92E-85 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 6.77E-57 mr1390 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 5.56E-06 mr1397 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 1.28E-06 1.21E-74 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.03E-56 mr1490 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 5.67E-08 1.29E-73 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.50E-72 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 6.06E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.21E-43 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.35E-08 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.38E-83 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.00E-51 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 5.80E-62 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.72E-77 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 2.70E-74 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.54E-62 mr1390_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.93E-83 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 1.62E-63 mr1490_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 9.64E-76 mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214800053 NA 3.78E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251