\
| Variant ID: vg1214779245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14779245 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTCCATCACAGGCTAGAAGTCACTGATGTGAAGAGTTATCTCAATTGGGCAAACGGCTGTCACGAATGAATATATCTCAATTGGGCCCTAAGTAAAGCC[C/T]
GTCATCGATAACTTTGACCCAGACAACCAGTCAAACTATAGCCCGTCACAGATAACCTATCTCTATCGGGCCACAACTAGCGCCCGTCACAGATGACTAC
GTAGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTTATCTGTGACGGGCTATAGTTTGACTGGTTGTCTGGGTCAAAGTTATCGATGAC[G/A]
GGCTTTACTTAGGGCCCAATTGAGATATATTCATTCGTGACAGCCGTTTGCCCAATTGAGATAACTCTTCACATCAGTGACTTCTAGCCTGTGATGGACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.50% | 3.90% | 23.59% | 50.97% | NA |
| All Indica | 2759 | 6.40% | 0.10% | 30.05% | 63.47% | NA |
| All Japonica | 1512 | 52.60% | 11.90% | 9.59% | 25.93% | NA |
| Aus | 269 | 5.20% | 0.00% | 30.11% | 64.68% | NA |
| Indica I | 595 | 8.90% | 0.00% | 21.01% | 70.08% | NA |
| Indica II | 465 | 6.50% | 0.00% | 27.31% | 66.24% | NA |
| Indica III | 913 | 3.20% | 0.20% | 38.44% | 58.16% | NA |
| Indica Intermediate | 786 | 8.30% | 0.00% | 28.75% | 62.98% | NA |
| Temperate Japonica | 767 | 79.00% | 5.60% | 5.22% | 10.17% | NA |
| Tropical Japonica | 504 | 20.40% | 18.50% | 14.88% | 46.23% | NA |
| Japonica Intermediate | 241 | 35.70% | 18.30% | 12.45% | 33.61% | NA |
| VI/Aromatic | 96 | 1.00% | 0.00% | 41.67% | 57.29% | NA |
| Intermediate | 90 | 34.40% | 2.20% | 22.22% | 41.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214779245 | C -> DEL | N | N | silent_mutation | Average:16.836; most accessible tissue: Callus, score: 49.092 | N | N | N | N |
| vg1214779245 | C -> T | LOC_Os12g25520.1 | upstream_gene_variant ; 1964.0bp to feature; MODIFIER | silent_mutation | Average:16.836; most accessible tissue: Callus, score: 49.092 | N | N | N | N |
| vg1214779245 | C -> T | LOC_Os12g25540.1 | upstream_gene_variant ; 3969.0bp to feature; MODIFIER | silent_mutation | Average:16.836; most accessible tissue: Callus, score: 49.092 | N | N | N | N |
| vg1214779245 | C -> T | LOC_Os12g25530.1 | downstream_gene_variant ; 681.0bp to feature; MODIFIER | silent_mutation | Average:16.836; most accessible tissue: Callus, score: 49.092 | N | N | N | N |
| vg1214779245 | C -> T | LOC_Os12g25520-LOC_Os12g25530 | intergenic_region ; MODIFIER | silent_mutation | Average:16.836; most accessible tissue: Callus, score: 49.092 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214779245 | 4.27E-06 | NA | mr1017 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214779245 | 3.37E-06 | NA | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214779245 | 3.66E-06 | NA | mr1023_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214779245 | NA | 8.88E-08 | mr1063_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214779245 | 2.14E-06 | NA | mr1489_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214779245 | NA | 7.71E-06 | mr1741_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |