Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214779245:

Variant ID: vg1214779245 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14779245
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCCATCACAGGCTAGAAGTCACTGATGTGAAGAGTTATCTCAATTGGGCAAACGGCTGTCACGAATGAATATATCTCAATTGGGCCCTAAGTAAAGCC[C/T]
GTCATCGATAACTTTGACCCAGACAACCAGTCAAACTATAGCCCGTCACAGATAACCTATCTCTATCGGGCCACAACTAGCGCCCGTCACAGATGACTAC

Reverse complement sequence

GTAGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTTATCTGTGACGGGCTATAGTTTGACTGGTTGTCTGGGTCAAAGTTATCGATGAC[G/A]
GGCTTTACTTAGGGCCCAATTGAGATATATTCATTCGTGACAGCCGTTTGCCCAATTGAGATAACTCTTCACATCAGTGACTTCTAGCCTGTGATGGACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.50%	3.90%	23.59%	50.97%	NA
All Indica	2759	6.40%	0.10%	30.05%	63.47%	NA
All Japonica	1512	52.60%	11.90%	9.59%	25.93%	NA
Aus	269	5.20%	0.00%	30.11%	64.68%	NA
Indica I	595	8.90%	0.00%	21.01%	70.08%	NA
Indica II	465	6.50%	0.00%	27.31%	66.24%	NA
Indica III	913	3.20%	0.20%	38.44%	58.16%	NA
Indica Intermediate	786	8.30%	0.00%	28.75%	62.98%	NA
Temperate Japonica	767	79.00%	5.60%	5.22%	10.17%	NA
Tropical Japonica	504	20.40%	18.50%	14.88%	46.23%	NA
Japonica Intermediate	241	35.70%	18.30%	12.45%	33.61%	NA
VI/Aromatic	96	1.00%	0.00%	41.67%	57.29%	NA
Intermediate	90	34.40%	2.20%	22.22%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214779245	C -> DEL	N	N	silent_mutation	Average:16.836; most accessible tissue: Callus, score: 49.092	N	N	N	N
vg1214779245	C -> T	LOC_Os12g25520.1	upstream_gene_variant ; 1964.0bp to feature; MODIFIER	silent_mutation	Average:16.836; most accessible tissue: Callus, score: 49.092	N	N	N	N
vg1214779245	C -> T	LOC_Os12g25540.1	upstream_gene_variant ; 3969.0bp to feature; MODIFIER	silent_mutation	Average:16.836; most accessible tissue: Callus, score: 49.092	N	N	N	N
vg1214779245	C -> T	LOC_Os12g25530.1	downstream_gene_variant ; 681.0bp to feature; MODIFIER	silent_mutation	Average:16.836; most accessible tissue: Callus, score: 49.092	N	N	N	N
vg1214779245	C -> T	LOC_Os12g25520-LOC_Os12g25530	intergenic_region ; MODIFIER	silent_mutation	Average:16.836; most accessible tissue: Callus, score: 49.092	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214779245	4.27E-06	NA	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245	3.37E-06	NA	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245	3.66E-06	NA	mr1023_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245	NA	8.88E-08	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245	2.14E-06	NA	mr1489_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245	NA	7.71E-06	mr1741_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251