\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214779245:

Variant ID: vg1214779245 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14779245
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCCATCACAGGCTAGAAGTCACTGATGTGAAGAGTTATCTCAATTGGGCAAACGGCTGTCACGAATGAATATATCTCAATTGGGCCCTAAGTAAAGCC[C/T]
GTCATCGATAACTTTGACCCAGACAACCAGTCAAACTATAGCCCGTCACAGATAACCTATCTCTATCGGGCCACAACTAGCGCCCGTCACAGATGACTAC

Reverse complement sequence

GTAGTCATCTGTGACGGGCGCTAGTTGTGGCCCGATAGAGATAGGTTATCTGTGACGGGCTATAGTTTGACTGGTTGTCTGGGTCAAAGTTATCGATGAC[G/A]
GGCTTTACTTAGGGCCCAATTGAGATATATTCATTCGTGACAGCCGTTTGCCCAATTGAGATAACTCTTCACATCAGTGACTTCTAGCCTGTGATGGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.50% 3.90% 23.59% 50.97% NA
All Indica  2759 6.40% 0.10% 30.05% 63.47% NA
All Japonica  1512 52.60% 11.90% 9.59% 25.93% NA
Aus  269 5.20% 0.00% 30.11% 64.68% NA
Indica I  595 8.90% 0.00% 21.01% 70.08% NA
Indica II  465 6.50% 0.00% 27.31% 66.24% NA
Indica III  913 3.20% 0.20% 38.44% 58.16% NA
Indica Intermediate  786 8.30% 0.00% 28.75% 62.98% NA
Temperate Japonica  767 79.00% 5.60% 5.22% 10.17% NA
Tropical Japonica  504 20.40% 18.50% 14.88% 46.23% NA
Japonica Intermediate  241 35.70% 18.30% 12.45% 33.61% NA
VI/Aromatic  96 1.00% 0.00% 41.67% 57.29% NA
Intermediate  90 34.40% 2.20% 22.22% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214779245 C -> DEL N N silent_mutation Average:16.836; most accessible tissue: Callus, score: 49.092 N N N N
vg1214779245 C -> T LOC_Os12g25520.1 upstream_gene_variant ; 1964.0bp to feature; MODIFIER silent_mutation Average:16.836; most accessible tissue: Callus, score: 49.092 N N N N
vg1214779245 C -> T LOC_Os12g25540.1 upstream_gene_variant ; 3969.0bp to feature; MODIFIER silent_mutation Average:16.836; most accessible tissue: Callus, score: 49.092 N N N N
vg1214779245 C -> T LOC_Os12g25530.1 downstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:16.836; most accessible tissue: Callus, score: 49.092 N N N N
vg1214779245 C -> T LOC_Os12g25520-LOC_Os12g25530 intergenic_region ; MODIFIER silent_mutation Average:16.836; most accessible tissue: Callus, score: 49.092 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214779245 4.27E-06 NA mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245 3.37E-06 NA mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245 3.66E-06 NA mr1023_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245 NA 8.88E-08 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245 2.14E-06 NA mr1489_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214779245 NA 7.71E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251