\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214775081:

Variant ID: vg1214775081 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14775081
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCCATTGTGAGGCTACATCTGAAATCACTGATCACTCTAGATCCCGTGCTGAATGCGGACTCAGATGCAACTGACGAAGTAGGCCATGCTAGCACATC[A/T]
TGTGCTATGCTAGCGATAGTTGGATACTTTGAGTGATTGGTCTTCCACCAATTTAGGATGTCAAATTTGTTCCCAAATTGCTGGATATGATTCTATTTGA

Reverse complement sequence

TCAAATAGAATCATATCCAGCAATTTGGGAACAAATTTGACATCCTAAATTGGTGGAAGACCAATCACTCAAAGTATCCAACTATCGCTAGCATAGCACA[T/A]
GATGTGCTAGCATGGCCTACTTCGTCAGTTGCATCTGAGTCCGCATTCAGCACGGGATCTAGAGTGATCAGTGATTTCAGATGTAGCCTCACAATGGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 24.20% 0.17% 8.29% NA
All Indica  2759 82.50% 3.50% 0.29% 13.66% NA
All Japonica  1512 32.50% 66.70% 0.00% 0.73% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 51.60% 4.20% 0.67% 43.53% NA
Indica II  465 92.50% 3.70% 0.43% 3.44% NA
Indica III  913 97.20% 2.10% 0.00% 0.77% NA
Indica Intermediate  786 83.10% 4.60% 0.25% 12.09% NA
Temperate Japonica  767 12.00% 87.90% 0.00% 0.13% NA
Tropical Japonica  504 59.10% 39.30% 0.00% 1.59% NA
Japonica Intermediate  241 42.30% 56.80% 0.00% 0.83% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 30.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214775081 A -> DEL N N silent_mutation Average:36.209; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1214775081 A -> T LOC_Os12g25520.1 downstream_gene_variant ; 93.0bp to feature; MODIFIER silent_mutation Average:36.209; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1214775081 A -> T LOC_Os12g25530.1 downstream_gene_variant ; 4845.0bp to feature; MODIFIER silent_mutation Average:36.209; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N
vg1214775081 A -> T LOC_Os12g25510-LOC_Os12g25520 intergenic_region ; MODIFIER silent_mutation Average:36.209; most accessible tissue: Minghui63 young leaf, score: 67.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214775081 NA 2.96E-12 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.73E-06 2.00E-39 mr1017 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.53E-12 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.15E-06 NA mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 6.54E-14 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 9.63E-13 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.40E-30 mr1022 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.51E-08 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 2.30E-06 1.23E-61 mr1023 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.92E-16 mr1023 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.19E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 5.23E-07 9.76E-39 mr1055 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.01E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.96E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.45E-06 2.86E-51 mr1079 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.86E-15 mr1079 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.55E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 4.28E-14 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.86E-06 9.09E-63 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 9.60E-17 mr1142 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.91E-13 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.02E-08 4.61E-70 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.16E-17 mr1489 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 5.94E-06 1.79E-13 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 7.65E-07 6.82E-65 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.79E-16 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.90E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.04E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 2.82E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 7.02E-06 7.76E-17 mr1778 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 8.12E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.72E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.52E-11 mr1019_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.09E-41 mr1022_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.14E-12 mr1022_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 2.81E-10 1.75E-81 mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 4.96E-07 9.61E-24 mr1023_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.06E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.35E-46 mr1055_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.87E-06 7.06E-61 mr1079_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 4.69E-19 mr1079_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.27E-16 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.65E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.61E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.79E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.31E-10 mr1261_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.71E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.59E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.04E-07 mr1334_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.46E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.75E-07 mr1401_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 7.31E-06 7.30E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 4.85E-06 mr1415_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.94E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 6.84E-06 6.84E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.63E-09 1.08E-80 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 6.69E-06 5.55E-21 mr1489_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 8.74E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.37E-06 mr1554_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 4.82E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.10E-09 mr1584_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.00E-08 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 9.09E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 9.65E-07 1.92E-06 mr1633_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.46E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 9.73E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.18E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.08E-06 mr1730_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 1.41E-07 NA mr1778_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 4.30E-18 mr1778_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.58E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.41E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.08E-07 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.97E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.29E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.98E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 5.67E-08 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 3.31E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 7.86E-10 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.14E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 1.79E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214775081 NA 2.82E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251