Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214720458:

Variant ID: vg1214720458 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14720458
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 127. )

Flanking Sequence (100 bp) in Reference Genome:

CTAAATATCTAAAATAGTGGGTCCATCAATTAAATGAAAATCGATTGTGAGATTAGATAGTGCCACGTGACGGTATAGGAGTGTTTATAGAGTGTCACGT[G/A]
GCGGCTTGAGAGCGTTTTTAGGATGTTTAATGGACTTTTAGTATATAATAGATAGATAATAGATAGATAGATAGATAATAGATACTGGTATGCTTTTTAT

Reverse complement sequence

ATAAAAAGCATACCAGTATCTATTATCTATCTATCTATCTATTATCTATCTATTATATACTAAAAGTCCATTAAACATCCTAAAAACGCTCTCAAGCCGC[C/T]
ACGTGACACTCTATAAACACTCCTATACCGTCACGTGGCACTATCTAATCTCACAATCGATTTTCATTTAATTGATGGACCCACTATTTTAGATATTTAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	8.80%	8.59%	2.50%	NA
All Indica	2759	72.90%	11.00%	11.92%	4.17%	NA
All Japonica	1512	88.60%	6.70%	4.50%	0.20%	NA
Aus	269	98.10%	1.10%	0.74%	0.00%	NA
Indica I	595	74.50%	3.00%	12.27%	10.25%	NA
Indica II	465	67.50%	13.10%	17.42%	1.94%	NA
Indica III	913	75.50%	15.60%	8.11%	0.88%	NA
Indica Intermediate	786	72.00%	10.40%	12.85%	4.71%	NA
Temperate Japonica	767	94.00%	2.90%	2.87%	0.26%	NA
Tropical Japonica	504	82.50%	10.70%	6.55%	0.20%	NA
Japonica Intermediate	241	84.20%	10.40%	5.39%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	7.80%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214720458	G -> DEL	N	N	silent_mutation	Average:49.634; most accessible tissue: Callus, score: 72.395	N	N	N	N
vg1214720458	G -> A	LOC_Os12g25450.1	upstream_gene_variant ; 3960.0bp to feature; MODIFIER	silent_mutation	Average:49.634; most accessible tissue: Callus, score: 72.395	N	N	N	N
vg1214720458	G -> A	LOC_Os12g25450-LOC_Os12g25460	intergenic_region ; MODIFIER	silent_mutation	Average:49.634; most accessible tissue: Callus, score: 72.395	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214720458	NA	8.85E-07	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.03E-06	3.03E-06	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	9.41E-09	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	6.23E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.03E-06	mr1221_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	6.09E-06	8.52E-08	mr1228_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.35E-07	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	9.74E-06	9.74E-06	mr1283_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	6.87E-06	NA	mr1289_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	1.94E-06	1.94E-06	mr1299_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	6.43E-06	6.43E-06	mr1345_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	3.87E-06	mr1379_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	5.39E-06	5.39E-06	mr1406_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.35E-06	3.35E-06	mr1407_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.22E-06	mr1415_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	1.83E-06	2.25E-10	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	5.27E-06	5.27E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	3.39E-08	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	5.28E-06	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.88E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.65E-07	mr1583_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	4.33E-06	4.34E-06	mr1605_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.21E-07	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	7.98E-06	mr1623_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.40E-06	mr1633_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	4.16E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.24E-06	3.24E-06	mr1700_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	3.82E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.98E-07	1.14E-06	mr1706_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	8.67E-06	8.67E-06	mr1727_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.40E-06	3.40E-06	mr1767_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.53E-07	mr1830_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.36E-07	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	7.18E-07	7.18E-07	mr1869_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	4.19E-07	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	3.75E-06	3.75E-06	mr1876_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.30E-07	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	5.21E-06	5.21E-06	mr1901_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	1.10E-08	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.20E-11	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	9.29E-07	9.29E-07	mr1921_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	3.07E-06	mr1924_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	NA	2.01E-07	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214720458	8.24E-06	8.24E-06	mr1960_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251