\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214674666:

Variant ID: vg1214674666 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14674666
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTCATCCGTGTCGTTTGAGAAGCACTTGCCTAGTTGTTTTAGAAAAGAGTTCAAATAAAATCAATTGTGAAAACAACAGCCTTTCCTTGAAGCCTGCA[A/T]
TAAACACTTATTTCCCCTGGCTTGCTGAGTACTCCCGTACTCACCCTTGCTCTATATAAATAATCCCCCCTAGTTGCTGAAGAAGATGAAGCGGATCGTG

Reverse complement sequence

CACGATCCGCTTCATCTTCTTCAGCAACTAGGGGGGATTATTTATATAGAGCAAGGGTGAGTACGGGAGTACTCAGCAAGCCAGGGGAAATAAGTGTTTA[T/A]
TGCAGGCTTCAAGGAAAGGCTGTTGTTTTCACAATTGATTTTATTTGAACTCTTTTCTAAAACAACTAGGCAAGTGCTTCTCAAACGACACGGATGAGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.00% 0.20% 15.26% 61.62% NA
All Indica  2759 6.20% 0.30% 21.96% 71.62% NA
All Japonica  1512 58.50% 0.10% 1.85% 39.62% NA
Aus  269 0.70% 0.00% 20.45% 78.81% NA
Indica I  595 3.50% 0.20% 20.67% 75.63% NA
Indica II  465 3.90% 0.20% 17.85% 78.06% NA
Indica III  913 6.70% 0.50% 26.29% 66.48% NA
Indica Intermediate  786 8.90% 0.00% 20.36% 70.74% NA
Temperate Japonica  767 86.80% 0.00% 0.39% 12.78% NA
Tropical Japonica  504 17.90% 0.20% 4.17% 77.78% NA
Japonica Intermediate  241 53.10% 0.00% 1.66% 45.23% NA
VI/Aromatic  96 3.10% 0.00% 15.62% 81.25% NA
Intermediate  90 28.90% 0.00% 18.89% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214674666 A -> DEL N N silent_mutation Average:6.58; most accessible tissue: Minghui63 young leaf, score: 9.976 N N N N
vg1214674666 A -> T LOC_Os12g25409-LOC_Os12g25420 intergenic_region ; MODIFIER silent_mutation Average:6.58; most accessible tissue: Minghui63 young leaf, score: 9.976 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214674666 NA 7.16E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 9.28E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 7.10E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 9.69E-06 NA mr1023_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.58E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 6.11E-06 mr1195_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 3.68E-06 9.94E-16 mr1217_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.46E-07 mr1217_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.59E-12 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 5.38E-08 mr1304_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 1.99E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 3.18E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 1.68E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 5.21E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 5.66E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 6.66E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 5.91E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.98E-13 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 1.60E-06 mr1830_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.71E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 2.37E-06 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 3.48E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214674666 NA 1.05E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251