\
| Variant ID: vg1214669115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14669115 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 245. )
ACAATGTTTTTTATATAAGGTGAAACAACACCCGATTTAAACGATTGAAACATTTTCGATCTACTTAGTGAAACAATTCCGATATACTTGGTGGAATATC[G/A]
TGCAACATTTTAAAATAATTCAATAATAAGCTAAAAAAATCGTTGGAATATATCCATGTGTTCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGGTG
CACCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGAACACATGGATATATTCCAACGATTTTTTTAGCTTATTATTGAATTATTTTAAAATGTTGCA[C/T]
GATATTCCACCAAGTATATCGGAATTGTTTCACTAAGTAGATCGAAAATGTTTCAATCGTTTAAATCGGGTGTTGTTTCACCTTATATAAAAAACATTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.30% | 8.70% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 85.60% | 14.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 54.10% | 45.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 12.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214669115 | G -> A | LOC_Os12g25409-LOC_Os12g25420 | intergenic_region ; MODIFIER | silent_mutation | Average:26.301; most accessible tissue: Minghui63 panicle, score: 38.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214669115 | NA | 3.54E-06 | mr1186 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 9.44E-06 | mr1308 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 4.33E-06 | mr1639 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 4.19E-06 | mr1164_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 1.10E-07 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 2.88E-08 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 7.12E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 3.99E-06 | mr1266_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | 1.65E-06 | 1.03E-08 | mr1308_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | 5.80E-06 | 4.41E-09 | mr1361_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | 8.59E-06 | 8.59E-06 | mr1487_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | 1.87E-06 | 1.87E-06 | mr1529_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 8.35E-06 | mr1637_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 1.80E-06 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | 5.32E-06 | 5.32E-06 | mr1853_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214669115 | NA | 3.28E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |