\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214656841:

Variant ID: vg1214656841 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14656841
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


GTAAGTACAGGAGGAGGCCAGGAGGGGAATATACAGGTAGTGGGGAACTGTGTGGAGAGGAGGATTTTATATTTTATTTCATCTAGTGGTTAAAAATGTT[G/A]
GACCCATCAATTTAAAGGAAAATCAACGGTTAGATTTTTAGACTGCCACTTGACGTCTTAGGAGCGTTTGTACGAGAACACATGGCAGCTTAGGAGCGTT

Reverse complement sequence

AACGCTCCTAAGCTGCCATGTGTTCTCGTACAAACGCTCCTAAGACGTCAAGTGGCAGTCTAAAAATCTAACCGTTGATTTTCCTTTAAATTGATGGGTC[C/T]
AACATTTTTAACCACTAGATGAAATAAAATATAAAATCCTCCTCTCCACACAGTTCCCCACTACCTGTATATTCCCCTCCTGGCCTCCTCCTGTACTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 19.40% 0.23% 16.93% NA
All Indica  2759 53.20% 18.10% 0.40% 28.38% NA
All Japonica  1512 77.40% 22.30% 0.00% 0.26% NA
Aus  269 81.00% 18.60% 0.00% 0.37% NA
Indica I  595 33.90% 46.60% 0.17% 19.33% NA
Indica II  465 54.40% 15.30% 0.65% 29.68% NA
Indica III  913 58.60% 3.40% 0.66% 37.35% NA
Indica Intermediate  786 60.70% 15.10% 0.13% 24.05% NA
Temperate Japonica  767 96.10% 3.50% 0.00% 0.39% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 19.90% 0.00% 0.41% NA
VI/Aromatic  96 70.80% 19.80% 0.00% 9.38% NA
Intermediate  90 81.10% 15.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214656841 G -> DEL N N silent_mutation Average:69.862; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1214656841 G -> A LOC_Os12g25409.1 upstream_gene_variant ; 3320.0bp to feature; MODIFIER silent_mutation Average:69.862; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1214656841 G -> A LOC_Os12g25400.1 downstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:69.862; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1214656841 G -> A LOC_Os12g25400-LOC_Os12g25409 intergenic_region ; MODIFIER silent_mutation Average:69.862; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214656841 NA 4.24E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 4.79E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 1.04E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 5.27E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 6.36E-09 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 2.57E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 2.82E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 3.84E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 5.25E-07 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 2.16E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 9.00E-07 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 1.28E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 4.67E-07 mr1442_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 3.35E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 3.18E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 6.90E-07 mr1578_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 4.64E-06 mr1629_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214656841 NA 3.69E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251