\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214655843:

Variant ID: vg1214655843 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14655843
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TAATGATTAGTGAAATCAATTTGAAAAAATACAATTAAAAAAACTGCCAACCGCCGGTTCTGGCTCTAGCAGTTTTAGTCTCGGTTAGTAACACCAATCG[G/A]
GACTAAAAATTGATTTTTTTTGTCCCGGTTATTTCACCAGGGACTAAAGATTCATACTCCCAGTTGCAAAACTGGGAGTACAGGGGGTTACAAACCGGGA

Reverse complement sequence

TCCCGGTTTGTAACCCCCTGTACTCCCAGTTTTGCAACTGGGAGTATGAATCTTTAGTCCCTGGTGAAATAACCGGGACAAAAAAAATCAATTTTTAGTC[C/T]
CGATTGGTGTTACTAACCGAGACTAAAACTGCTAGAGCCAGAACCGGCGGTTGGCAGTTTTTTTAATTGTATTTTTTCAAATTGATTTCACTAATCATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.60% 17.30% 5.54% 5.59% NA
All Indica  2759 66.50% 17.60% 7.97% 7.90% NA
All Japonica  1512 77.90% 17.70% 1.85% 2.58% NA
Aus  269 81.80% 15.20% 1.49% 1.49% NA
Indica I  595 39.20% 46.90% 6.22% 7.73% NA
Indica II  465 71.80% 13.10% 7.53% 7.53% NA
Indica III  913 77.70% 3.00% 10.84% 8.54% NA
Indica Intermediate  786 71.20% 15.00% 6.23% 7.51% NA
Temperate Japonica  767 96.10% 3.00% 0.65% 0.26% NA
Tropical Japonica  504 49.80% 40.90% 3.37% 5.95% NA
Japonica Intermediate  241 78.80% 15.80% 2.49% 2.90% NA
VI/Aromatic  96 80.20% 14.60% 4.17% 1.04% NA
Intermediate  90 78.90% 12.20% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214655843 G -> DEL N N silent_mutation Average:31.413; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1214655843 G -> A LOC_Os12g25390.1 upstream_gene_variant ; 4784.0bp to feature; MODIFIER silent_mutation Average:31.413; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1214655843 G -> A LOC_Os12g25409.1 upstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:31.413; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1214655843 G -> A LOC_Os12g25400.1 downstream_gene_variant ; 2874.0bp to feature; MODIFIER silent_mutation Average:31.413; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N
vg1214655843 G -> A LOC_Os12g25400-LOC_Os12g25409 intergenic_region ; MODIFIER silent_mutation Average:31.413; most accessible tissue: Minghui63 young leaf, score: 47.146 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214655843 NA 9.32E-06 mr1308 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 1.58E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 8.08E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 1.30E-08 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 6.14E-06 6.13E-06 mr1171_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 1.98E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 6.34E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 8.49E-08 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 3.44E-06 1.92E-08 mr1308_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 7.24E-06 7.24E-06 mr1356_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 2.69E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 7.10E-08 mr1361_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 4.09E-06 mr1442_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 1.95E-06 mr1442_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 8.29E-06 mr1469_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 5.80E-06 mr1469_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 2.55E-06 2.55E-06 mr1487_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 1.34E-06 mr1521_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 6.85E-06 6.85E-06 mr1529_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 8.64E-06 6.52E-09 mr1578_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 9.25E-06 mr1603_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 2.44E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 4.47E-06 mr1649_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 NA 4.77E-06 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 1.51E-06 1.51E-06 mr1819_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214655843 8.16E-06 8.16E-06 mr1967_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251