\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214649117:

Variant ID: vg1214649117 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14649117
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCATGAATCGCCTTGCTGTCGGCCTCCGTTTGGTCCTCCCCAAAATCCGTGTCGTACTGCAACTGCACATCGTAAGATTGTACATGACGATCTTGAGCA[A/G]
GAGGGGCTAAAGGAGCAGAGGTGGGTCTCTTTGGTGGACGACCGCCTGGTGCAGTGGTTGGCCTCGCTGTAACCCTGATCTCAATGAGGTCCATGGGCCA

Reverse complement sequence

TGGCCCATGGACCTCATTGAGATCAGGGTTACAGCGAGGCCAACCACTGCACCAGGCGGTCGTCCACCAAAGAGACCCACCTCTGCTCCTTTAGCCCCTC[T/C]
TGCTCAAGATCGTCATGTACAATCTTACGATGTGCAGTTGCAGTACGACACGGATTTTGGGGAGGACCAAACGGAGGCCGACAGCAAGGCGATTCATGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 12.80% 8.17% 18.58% NA
All Indica  2759 60.60% 1.60% 7.61% 30.23% NA
All Japonica  1512 52.00% 35.80% 10.52% 1.72% NA
Aus  269 96.70% 0.40% 1.49% 1.49% NA
Indica I  595 75.30% 0.80% 3.19% 20.67% NA
Indica II  465 56.10% 1.90% 10.75% 31.18% NA
Indica III  913 51.70% 0.90% 7.56% 39.87% NA
Indica Intermediate  786 62.50% 2.70% 9.16% 25.70% NA
Temperate Japonica  767 35.90% 56.50% 6.91% 0.78% NA
Tropical Japonica  504 68.30% 13.50% 15.28% 2.98% NA
Japonica Intermediate  241 69.30% 16.60% 12.03% 2.07% NA
VI/Aromatic  96 88.50% 0.00% 2.08% 9.38% NA
Intermediate  90 61.10% 21.10% 12.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214649117 A -> DEL N N silent_mutation Average:38.5; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1214649117 A -> G LOC_Os12g25380.1 upstream_gene_variant ; 2941.0bp to feature; MODIFIER silent_mutation Average:38.5; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1214649117 A -> G LOC_Os12g25400.1 upstream_gene_variant ; 3417.0bp to feature; MODIFIER silent_mutation Average:38.5; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N
vg1214649117 A -> G LOC_Os12g25390.1 intron_variant ; MODIFIER silent_mutation Average:38.5; most accessible tissue: Minghui63 young leaf, score: 60.103 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214649117 NA 4.16E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 8.61E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 2.78E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 5.46E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 1.60E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 1.13E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 2.72E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 3.52E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 2.94E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 5.46E-07 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 1.76E-06 1.75E-06 mr1569_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 2.41E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 8.21E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 4.42E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 2.43E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 7.43E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 5.18E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 3.41E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 1.20E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 2.38E-06 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214649117 NA 1.24E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251