\
| Variant ID: vg1214648997 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14648997 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGGCCTAAAATAGAGCCCGTCACAGATGACTACTCACCTCAATCGGGCCTAAACTAGAGCCCGTCACAGATGACTACTGACCTCAATCGGGCCTTCCTG[T/C]
TCTTCTTCATCGGTGGGGGTTCATGAATCGCCTTGCTGTCGGCCTCCGTTTGGTCCTCCCCAAAATCCGTGTCGTACTGCAACTGCACATCGTAAGATTG
CAATCTTACGATGTGCAGTTGCAGTACGACACGGATTTTGGGGAGGACCAAACGGAGGCCGACAGCAAGGCGATTCATGAACCCCCACCGATGAAGAAGA[A/G]
CAGGAAGGCCCGATTGAGGTCAGTAGTCATCTGTGACGGGCTCTAGTTTAGGCCCGATTGAGGTGAGTAGTCATCTGTGACGGGCTCTATTTTAGGCCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.30% | 10.40% | 0.93% | 17.35% | NA |
| All Indica | 2759 | 69.60% | 0.90% | 0.43% | 29.10% | NA |
| All Japonica | 1512 | 68.10% | 29.70% | 1.98% | 0.26% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 79.30% | 0.50% | 0.34% | 19.83% | NA |
| Indica II | 465 | 67.70% | 0.90% | 1.08% | 30.32% | NA |
| Indica III | 913 | 61.40% | 0.20% | 0.00% | 38.34% | NA |
| Indica Intermediate | 786 | 72.60% | 2.00% | 0.64% | 24.68% | NA |
| Temperate Japonica | 767 | 43.40% | 53.10% | 3.13% | 0.39% | NA |
| Tropical Japonica | 504 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 14.90% | 2.49% | 0.41% | NA |
| VI/Aromatic | 96 | 90.60% | 0.00% | 0.00% | 9.38% | NA |
| Intermediate | 90 | 75.60% | 18.90% | 2.22% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214648997 | T -> C | LOC_Os12g25390.1 | missense_variant ; p.Asn449Ser; MODERATE | nonsynonymous_codon | Average:43.835; most accessible tissue: Minghui63 young leaf, score: 71.839 | unknown | unknown | TOLERATED | 1.00 |
| vg1214648997 | T -> DEL | LOC_Os12g25390.1 | N | frameshift_variant | Average:43.835; most accessible tissue: Minghui63 young leaf, score: 71.839 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214648997 | 5.22E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 1.01E-08 | NA | mr1926 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | NA | 1.86E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | NA | 4.75E-11 | mr1959 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 9.13E-07 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 9.77E-09 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 1.11E-07 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 2.81E-06 | NA | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 5.44E-06 | 5.44E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 1.21E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 2.85E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 4.20E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | 6.22E-08 | 4.35E-17 | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214648997 | NA | 8.78E-08 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |