Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214644530:

Variant ID: vg1214644530 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14644530
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.17, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTTTGATTGATCCAAAATTATGTTGAGGTTCTTCTTACCATCAGAAAATCTTAGCAAAGAATTTTTCAAATAAGACACCTCTTTTTCCAAATTAGCA[C/T]
AATTTTCACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCACTTCATTTTTTTTCACAACATCTTCCATGTACTCAACACGACC

Reverse complement sequence

GGTCGTGTTGAGTACATGGAAGATGTTGTGAAAAAAAATGAAGTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTGAAAATT[G/A]
TGCTAATTTGGAAAAAGAGGTGTCTTATTTGAAAAATTCTTTGCTAAGATTTTCTGATGGTAAGAAGAACCTCAACATAATTTTGGATCAATCAAAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	38.80%	3.64%	16.06%	NA
All Indica	2759	22.10%	46.10%	5.00%	26.82%	NA
All Japonica	1512	80.90%	18.10%	0.53%	0.46%	NA
Aus	269	23.00%	71.00%	5.58%	0.37%	NA
Indica I	595	49.10%	30.40%	2.35%	18.15%	NA
Indica II	465	19.60%	45.60%	3.23%	31.61%	NA
Indica III	913	6.60%	51.60%	8.32%	33.52%	NA
Indica Intermediate	786	21.10%	51.90%	4.20%	22.77%	NA
Temperate Japonica	767	89.80%	9.80%	0.00%	0.39%	NA
Tropical Japonica	504	70.40%	28.20%	0.99%	0.40%	NA
Japonica Intermediate	241	74.30%	23.70%	1.24%	0.83%	NA
VI/Aromatic	96	22.90%	62.50%	6.25%	8.33%	NA
Intermediate	90	48.90%	42.20%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214644530	C -> DEL	LOC_Os12g25380.1	N	frameshift_variant	Average:14.9; most accessible tissue: Zhenshan97 root, score: 18.731	N	N	N	N
vg1214644530	C -> T	LOC_Os12g25380.1	missense_variant ; p.Cys403Tyr; MODERATE	nonsynonymous_codon ; C403Y	Average:14.9; most accessible tissue: Zhenshan97 root, score: 18.731	unknown	unknown	DELETERIOUS	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214644530	NA	2.34E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	1.65E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.88E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	6.86E-06	NA	mr1324	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	7.58E-06	7.58E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	2.66E-06	NA	mr1326	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	9.52E-07	9.52E-07	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.19E-07	mr1346	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.55E-06	mr1456	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	3.30E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	4.16E-06	mr1792	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.97E-07	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.22E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	5.67E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	3.43E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	5.89E-07	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	4.81E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	3.51E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	8.72E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	1.12E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.68E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	4.35E-08	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.01E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	1.50E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	3.10E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530	NA	2.16E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251