\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214644530:

Variant ID: vg1214644530 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14644530
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.84, C: 0.17, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTTTGATTGATCCAAAATTATGTTGAGGTTCTTCTTACCATCAGAAAATCTTAGCAAAGAATTTTTCAAATAAGACACCTCTTTTTCCAAATTAGCA[C/T]
AATTTTCACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCACTTCATTTTTTTTCACAACATCTTCCATGTACTCAACACGACC

Reverse complement sequence

GGTCGTGTTGAGTACATGGAAGATGTTGTGAAAAAAAATGAAGTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTGAAAATT[G/A]
TGCTAATTTGGAAAAAGAGGTGTCTTATTTGAAAAATTCTTTGCTAAGATTTTCTGATGGTAAGAAGAACCTCAACATAATTTTGGATCAATCAAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 38.80% 3.64% 16.06% NA
All Indica  2759 22.10% 46.10% 5.00% 26.82% NA
All Japonica  1512 80.90% 18.10% 0.53% 0.46% NA
Aus  269 23.00% 71.00% 5.58% 0.37% NA
Indica I  595 49.10% 30.40% 2.35% 18.15% NA
Indica II  465 19.60% 45.60% 3.23% 31.61% NA
Indica III  913 6.60% 51.60% 8.32% 33.52% NA
Indica Intermediate  786 21.10% 51.90% 4.20% 22.77% NA
Temperate Japonica  767 89.80% 9.80% 0.00% 0.39% NA
Tropical Japonica  504 70.40% 28.20% 0.99% 0.40% NA
Japonica Intermediate  241 74.30% 23.70% 1.24% 0.83% NA
VI/Aromatic  96 22.90% 62.50% 6.25% 8.33% NA
Intermediate  90 48.90% 42.20% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214644530 C -> DEL LOC_Os12g25380.1 N frameshift_variant Average:14.9; most accessible tissue: Zhenshan97 root, score: 18.731 N N N N
vg1214644530 C -> T LOC_Os12g25380.1 missense_variant ; p.Cys403Tyr; MODERATE nonsynonymous_codon ; C403Y Average:14.9; most accessible tissue: Zhenshan97 root, score: 18.731 unknown unknown DELETERIOUS 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214644530 NA 2.34E-08 mr1019 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 1.65E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.88E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 6.86E-06 NA mr1324 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 7.58E-06 7.58E-06 mr1325 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 2.66E-06 NA mr1326 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 9.52E-07 9.52E-07 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.19E-07 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.55E-06 mr1456 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 3.30E-07 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 4.16E-06 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.97E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.22E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 5.67E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 3.43E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 5.89E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 4.81E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 3.51E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 8.72E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 1.12E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.68E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 4.35E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.01E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 1.50E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 3.10E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644530 NA 2.16E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251