Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214644504:

Variant ID: vg1214644504 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14644504
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

AAACCTAAACCACGATTATGTGTGCTAACCTTTGATTGATCCAAAATTATGTTGAGGTTCTTCTTACCATCAGAAAATCTTAGCAAAGAATTTTTCAAAT[A/T]
AGACACCTCTTTTTCCAAATTAGCACAATTTTCACAATCTACCATGACACCTTTGCTTTTACGACACTTGGGGCAAGAAAGCACTTCATTTTTTTTCACA

Reverse complement sequence

TGTGAAAAAAAATGAAGTGCTTTCTTGCCCCAAGTGTCGTAAAAGCAAAGGTGTCATGGTAGATTGTGAAAATTGTGCTAATTTGGAAAAAGAGGTGTCT[T/A]
ATTTGAAAAATTCTTTGCTAAGATTTTCTGATGGTAAGAAGAACCTCAACATAATTTTGGATCAATCAAAGGTTAGCACACATAATCGTGGTTTAGGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.40%	13.10%	21.84%	23.68%	NA
All Indica	2759	22.10%	13.00%	27.08%	37.73%	NA
All Japonica	1512	80.90%	9.60%	5.95%	3.57%	NA
Aus	269	20.40%	29.00%	49.44%	1.12%	NA
Indica I	595	49.20%	9.40%	18.32%	23.03%	NA
Indica II	465	20.20%	11.40%	24.52%	43.87%	NA
Indica III	913	6.70%	15.00%	29.68%	48.63%	NA
Indica Intermediate	786	20.70%	14.50%	32.19%	32.57%	NA
Temperate Japonica	767	90.10%	6.00%	2.09%	1.83%	NA
Tropical Japonica	504	70.00%	13.30%	10.91%	5.75%	NA
Japonica Intermediate	241	74.30%	13.30%	7.88%	4.56%	NA
VI/Aromatic	96	22.90%	25.00%	42.71%	9.38%	NA
Intermediate	90	51.10%	12.20%	23.33%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214644504	A -> DEL	LOC_Os12g25380.1	N	frameshift_variant	Average:15.291; most accessible tissue: Minghui63 flag leaf, score: 19.18	N	N	N	N
vg1214644504	A -> T	LOC_Os12g25380.1	missense_variant ; p.Tyr412Asn; MODERATE	nonsynonymous_codon ; Y412N	Average:15.291; most accessible tissue: Minghui63 flag leaf, score: 19.18	unknown	unknown	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214644504	NA	2.34E-08	mr1019	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.65E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	2.88E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	5.74E-06	NA	mr1324	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	7.58E-06	7.58E-06	mr1325	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	2.59E-06	NA	mr1326	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	9.52E-07	9.52E-07	mr1326	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	4.63E-06	5.21E-08	mr1346	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.10E-06	mr1456	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	6.40E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	4.33E-07	mr1587	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.79E-07	mr1603	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.28E-06	mr1792	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	3.63E-08	mr1803	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	2.22E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	5.67E-06	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	3.43E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	9.34E-08	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	4.81E-08	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	5.33E-06	mr1456_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	3.51E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.83E-06	mr1577_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.12E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	2.68E-08	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	3.66E-09	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	2.01E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	1.50E-07	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	3.10E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214644504	NA	2.16E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251