\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214643661:

Variant ID: vg1214643661 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14643661
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATTTCTCATTTACCTTAACCAAACCTGTAGCGAGAACGGCACTTGTAGAAGCATCACCAAAGATAATCGATTCAGTCTTTGATGCCTTCTTGAGT[G/A]
AGGAGAACCAATTTTTATCACCGGTCATGTGCCGCGAACAACCGGAATCCACGATTCACACGTTCTCCTTCCTTGCCACCAAAGCCTACACACAAGCAGA

Reverse complement sequence

TCTGCTTGTGTGTAGGCTTTGGTGGCAAGGAAGGAGAACGTGTGAATCGTGGATTCCGGTTGTTCGCGGCACATGACCGGTGATAAAAATTGGTTCTCCT[C/T]
ACTCAAGAAGGCATCAAAGACTGAATCGATTATCTTTGGTGATGCTTCTACAAGTGCCGTTCTCGCTACAGGTTTGGTTAAGGTAAATGAGAAATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 34.50% 7.30% 16.10% NA
All Indica  2759 23.50% 38.90% 10.84% 26.75% NA
All Japonica  1512 80.80% 16.30% 2.31% 0.66% NA
Aus  269 20.10% 78.80% 0.74% 0.37% NA
Indica I  595 49.40% 25.70% 6.55% 18.32% NA
Indica II  465 21.50% 33.10% 16.34% 29.03% NA
Indica III  913 8.30% 46.30% 11.39% 33.95% NA
Indica Intermediate  786 22.60% 43.80% 10.18% 23.41% NA
Temperate Japonica  767 89.70% 7.80% 1.69% 0.78% NA
Tropical Japonica  504 70.20% 25.40% 3.77% 0.60% NA
Japonica Intermediate  241 74.30% 24.10% 1.24% 0.41% NA
VI/Aromatic  96 21.90% 68.80% 1.04% 8.33% NA
Intermediate  90 50.00% 36.70% 8.89% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214643661 G -> DEL N N silent_mutation Average:24.195; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1214643661 G -> A LOC_Os12g25380.1 splice_region_variant&intron_variant ; LOW silent_mutation Average:24.195; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg1214643661 G -> A LOC_Os12g25390.1 downstream_gene_variant ; 4702.0bp to feature; MODIFIER silent_mutation Average:24.195; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214643661 NA 2.14E-06 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 5.27E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 9.13E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 1.43E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 5.57E-06 NA mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 1.88E-07 1.88E-07 mr1325 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 1.68E-08 1.68E-08 mr1326 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 2.88E-07 2.88E-07 mr1333 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 8.50E-08 mr1346 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.26E-06 mr1456 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 2.99E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 4.50E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 5.72E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 5.39E-07 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 5.13E-06 mr1603 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 7.60E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 3.57E-07 mr1686 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 4.17E-07 4.17E-07 mr1690 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 9.63E-06 mr1725 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 9.66E-06 mr1780 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 8.11E-08 mr1792 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 7.12E-09 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 7.54E-06 2.74E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 2.94E-07 NA mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.75E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 2.98E-06 2.98E-06 mr1326_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 1.16E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 9.60E-06 9.60E-06 mr1407_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.61E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.44E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 4.18E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 7.64E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 5.35E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 4.33E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 9.88E-06 mr1633_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 4.86E-09 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 7.22E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 1.37E-08 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.38E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 6.87E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214643661 NA 9.16E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251