\
| Variant ID: vg1214642525 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 14642525 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 96. )
ACCCGAACCCGACGACCCTGGCTGGTCTGACCGCTCCTCATGGGCCGGTCTGACCGGAGGTGTGCCGGCGGTCTGACCGGCCTGGCGCCCGGTCTGACCG[G/A]
CCGAGCTGACCTCGTCGTCGTCGTTGTCTCCGCTCTCGTCTTCAAAAATACAACCATCCTCCCCCTGAACCTATGACAGTGTACCTGCAATATCGGGTCT
AGACCCGATATTGCAGGTACACTGTCATAGGTTCAGGGGGAGGATGGTTGTATTTTTGAAGACGAGAGCGGAGACAACGACGACGACGAGGTCAGCTCGG[C/T]
CGGTCAGACCGGGCGCCAGGCCGGTCAGACCGCCGGCACACCTCCGGTCAGACCGGCCCATGAGGAGCGGTCAGACCAGCCAGGGTCGTCGGGTTCGGGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.20% | 15.40% | 2.03% | 12.27% | NA |
| All Indica | 2759 | 60.10% | 16.40% | 2.86% | 20.59% | NA |
| All Japonica | 1512 | 99.20% | 0.40% | 0.13% | 0.26% | NA |
| Aus | 269 | 26.40% | 69.50% | 4.09% | 0.00% | NA |
| Indica I | 595 | 62.70% | 22.20% | 0.50% | 14.62% | NA |
| Indica II | 465 | 69.50% | 3.40% | 3.23% | 23.87% | NA |
| Indica III | 913 | 53.10% | 16.80% | 4.49% | 25.63% | NA |
| Indica Intermediate | 786 | 60.80% | 19.30% | 2.54% | 17.30% | NA |
| Temperate Japonica | 767 | 99.50% | 0.10% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.70% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 21.90% | 68.80% | 2.08% | 7.29% | NA |
| Intermediate | 90 | 76.70% | 20.00% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1214642525 | G -> DEL | LOC_Os12g25380.1 | N | frameshift_variant | Average:20.721; most accessible tissue: Callus, score: 36.725 | N | N | N | N |
| vg1214642525 | G -> A | LOC_Os12g25380.1 | missense_variant ; p.Ala549Val; MODERATE | nonsynonymous_codon ; A549V | Average:20.721; most accessible tissue: Callus, score: 36.725 | unknown | unknown | TOLERATED | 0.63 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1214642525 | NA | 2.68E-06 | mr1346 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | 7.31E-07 | NA | mr1540 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | 1.10E-07 | 1.10E-07 | mr1540 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 4.55E-06 | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 1.39E-06 | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | 3.58E-06 | 8.58E-07 | mr1732 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | 9.12E-06 | 1.23E-07 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 1.73E-08 | mr1803 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 2.65E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 9.41E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1214642525 | NA | 1.66E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |