Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214637266:

Variant ID: vg1214637266 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 14637266
Reference Allele: G	Alternative Allele: T,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

TTGATTTATTTAAATACTTCTTTTTTATTTTTAAACCATCCTTTAGCCACCAAAAAGCCATCGTGGGAACTTTACGCCTTCCATGGAGACGTTTGCGTAG[G/T,C]
CTCAGACCCCGACGTCAAACCGTTGGTCGTAAAACCCGGCATAACCTAATCCTAAGGTCGAAGTGTTGCTCTTCGCACCCCACGCCTCGACGCGTATAGT

Reverse complement sequence

ACTATACGCGTCGAGGCGTGGGGTGCGAAGAGCAACACTTCGACCTTAGGATTAGGTTATGCCGGGTTTTACGACCAACGGTTTGACGTCGGGGTCTGAG[C/A,G]
CTACGCAAACGTCTCCATGGAAGGCGTAAAGTTCCCACGATGGCTTTTTGGTGGCTAAAGGATGGTTTAAAAATAAAAAAGAAGTATTTAAATAAATCAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.40%	11.90%	2.05%	21.63%	C: 0.06%
All Indica	2759	60.90%	1.10%	1.67%	36.25%	C: 0.11%
All Japonica	1512	62.50%	33.90%	3.17%	0.46%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	79.00%	0.70%	1.51%	18.82%	NA
Indica II	465	40.90%	1.70%	1.51%	55.48%	C: 0.43%
Indica III	913	58.40%	0.50%	0.88%	40.09%	C: 0.11%
Indica Intermediate	786	61.80%	1.80%	2.80%	33.59%	NA
Temperate Japonica	767	40.40%	53.60%	5.35%	0.65%	NA
Tropical Japonica	504	86.50%	13.50%	0.00%	0.00%	NA
Japonica Intermediate	241	82.60%	13.70%	2.90%	0.83%	NA
VI/Aromatic	96	90.60%	0.00%	0.00%	9.38%	NA
Intermediate	90	72.20%	18.90%	3.33%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1214637266	G -> C	LOC_Os12g25370.1	upstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> C	LOC_Os12g25360.1	downstream_gene_variant ; 3486.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> C	LOC_Os12g25380.1	downstream_gene_variant ; 4109.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> C	LOC_Os12g25370-LOC_Os12g25380	intergenic_region ; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> DEL	N	N	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> T	LOC_Os12g25370.1	upstream_gene_variant ; 580.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> T	LOC_Os12g25360.1	downstream_gene_variant ; 3486.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> T	LOC_Os12g25380.1	downstream_gene_variant ; 4109.0bp to feature; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg1214637266	G -> T	LOC_Os12g25370-LOC_Os12g25380	intergenic_region ; MODIFIER	silent_mutation	Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1214637266	NA	1.49E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	4.64E-07	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	4.08E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	9.39E-06	mr1266_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	2.05E-06	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	3.26E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	2.44E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	5.60E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	5.69E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	1.33E-07	NA	mr1484_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	4.07E-06	4.05E-06	mr1569_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	3.39E-09	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	1.68E-06	NA	mr1609_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	1.72E-10	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	6.09E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	2.56E-07	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	3.92E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	3.89E-07	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	2.43E-09	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	1.39E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	NA	2.77E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	9.31E-07	NA	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266	3.49E-06	8.03E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251