\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214637266:

Variant ID: vg1214637266 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14637266
Reference Allele: GAlternative Allele: T,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TTGATTTATTTAAATACTTCTTTTTTATTTTTAAACCATCCTTTAGCCACCAAAAAGCCATCGTGGGAACTTTACGCCTTCCATGGAGACGTTTGCGTAG[G/T,C]
CTCAGACCCCGACGTCAAACCGTTGGTCGTAAAACCCGGCATAACCTAATCCTAAGGTCGAAGTGTTGCTCTTCGCACCCCACGCCTCGACGCGTATAGT

Reverse complement sequence

ACTATACGCGTCGAGGCGTGGGGTGCGAAGAGCAACACTTCGACCTTAGGATTAGGTTATGCCGGGTTTTACGACCAACGGTTTGACGTCGGGGTCTGAG[C/A,G]
CTACGCAAACGTCTCCATGGAAGGCGTAAAGTTCCCACGATGGCTTTTTGGTGGCTAAAGGATGGTTTAAAAATAAAAAAGAAGTATTTAAATAAATCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 11.90% 2.05% 21.63% C: 0.06%
All Indica  2759 60.90% 1.10% 1.67% 36.25% C: 0.11%
All Japonica  1512 62.50% 33.90% 3.17% 0.46% NA
Aus  269 98.90% 0.70% 0.00% 0.37% NA
Indica I  595 79.00% 0.70% 1.51% 18.82% NA
Indica II  465 40.90% 1.70% 1.51% 55.48% C: 0.43%
Indica III  913 58.40% 0.50% 0.88% 40.09% C: 0.11%
Indica Intermediate  786 61.80% 1.80% 2.80% 33.59% NA
Temperate Japonica  767 40.40% 53.60% 5.35% 0.65% NA
Tropical Japonica  504 86.50% 13.50% 0.00% 0.00% NA
Japonica Intermediate  241 82.60% 13.70% 2.90% 0.83% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 72.20% 18.90% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214637266 G -> C LOC_Os12g25370.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> C LOC_Os12g25360.1 downstream_gene_variant ; 3486.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> C LOC_Os12g25380.1 downstream_gene_variant ; 4109.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> C LOC_Os12g25370-LOC_Os12g25380 intergenic_region ; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> DEL N N silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> T LOC_Os12g25370.1 upstream_gene_variant ; 580.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> T LOC_Os12g25360.1 downstream_gene_variant ; 3486.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> T LOC_Os12g25380.1 downstream_gene_variant ; 4109.0bp to feature; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg1214637266 G -> T LOC_Os12g25370-LOC_Os12g25380 intergenic_region ; MODIFIER silent_mutation Average:53.309; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214637266 NA 1.49E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 4.64E-07 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 4.08E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 9.39E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 2.05E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 3.26E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 2.44E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 5.60E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 5.69E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 1.33E-07 NA mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 4.07E-06 4.05E-06 mr1569_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 3.39E-09 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 1.68E-06 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 1.72E-10 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 6.09E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 2.56E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 3.92E-07 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 3.89E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 2.43E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 1.39E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 NA 2.77E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 9.31E-07 NA mr1945_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214637266 3.49E-06 8.03E-15 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251