\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214636161:

Variant ID: vg1214636161 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14636161
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCTCCTCCTCTGGGTGCACTTGGCGCACGCACAGGGCGCCGCCTTCGCCGCCGTCTCGCCACTTCCCGATGCCGCCCGCCGTTTTGCGCCGCCGCCG[T/C]
CGTCTTGCCTTCGACGCGAAGGATCCGTCACCAACGTCAGCTGCGACATCACGCCGCCGACGTCAGCCGCCGAATCGAACCGCCGAATCAACGAATAGAG

Reverse complement sequence

CTCTATTCGTTGATTCGGCGGTTCGATTCGGCGGCTGACGTCGGCGGCGTGATGTCGCAGCTGACGTTGGTGACGGATCCTTCGCGTCGAAGGCAAGACG[A/G]
CGGCGGCGGCGCAAAACGGCGGGCGGCATCGGGAAGTGGCGAGACGGCGGCGAAGGCGGCGCCCTGTGCGTGCGCCAAGTGCACCCAGAGGAGGAGGGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.40% 35.30% 0.68% 22.62% NA
All Indica  2759 22.60% 39.10% 0.83% 37.48% NA
All Japonica  1512 80.50% 17.60% 0.60% 1.32% NA
Aus  269 19.70% 79.90% 0.00% 0.37% NA
Indica I  595 50.60% 30.90% 0.00% 18.49% NA
Indica II  465 20.60% 22.20% 1.94% 55.27% NA
Indica III  913 6.60% 49.60% 0.66% 43.15% NA
Indica Intermediate  786 21.20% 43.00% 1.02% 34.73% NA
Temperate Japonica  767 89.80% 8.70% 0.26% 1.17% NA
Tropical Japonica  504 69.60% 28.20% 0.60% 1.59% NA
Japonica Intermediate  241 73.40% 23.70% 1.66% 1.24% NA
VI/Aromatic  96 20.80% 69.80% 0.00% 9.38% NA
Intermediate  90 46.70% 47.80% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214636161 T -> C LOC_Os12g25370.1 missense_variant ; p.Asp86Gly; MODERATE nonsynonymous_codon ; D86G Average:75.966; most accessible tissue: Zhenshan97 panicle, score: 96.982 unknown unknown TOLERATED 0.44
vg1214636161 T -> DEL LOC_Os12g25370.1 N frameshift_variant Average:75.966; most accessible tissue: Zhenshan97 panicle, score: 96.982 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1214636161 T C -0.04 -0.03 -0.04 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214636161 NA 5.89E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 3.15E-06 3.15E-06 mr1194 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 7.92E-06 7.92E-06 mr1326 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 9.21E-06 mr1378 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 4.17E-07 mr1803 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 4.56E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 2.60E-06 mr1039_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 8.34E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 4.39E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 8.65E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 1.47E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 3.82E-08 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 7.29E-07 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 8.39E-06 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 1.52E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214636161 NA 1.09E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251