\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1214629307:

Variant ID: vg1214629307 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 14629307
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAATTCGATAGAACATCAATGGGTTCTTGCCGTGGTAGCTAGGATGCAAATCCTCTACAGTACTGCTGATGCAGTAGCAGTGGTTGACATGTGGGTC[C/T]
GGGCCCACATGTCAGTGTCTGCTACTGCATCACTGTGGTAGCTAGGGTTGGGAGTAACCGGGAACCATCTTATTACACACAACCATCTTCCTACAAAATT

Reverse complement sequence

AATTTTGTAGGAAGATGGTTGTGTGTAATAAGATGGTTCCCGGTTACTCCCAACCCTAGCTACCACAGTGATGCAGTAGCAGACACTGACATGTGGGCCC[G/A]
GACCCACATGTCAACCACTGCTACTGCATCAGCAGTACTGTAGAGGATTTGCATCCTAGCTACCACGGCAAGAACCCATTGATGTTCTATCGAATTTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 17.80% 0.40% 16.55% NA
All Indica  2759 66.40% 5.40% 0.58% 27.62% NA
All Japonica  1512 77.60% 21.80% 0.07% 0.53% NA
Aus  269 4.80% 94.80% 0.00% 0.37% NA
Indica I  595 81.30% 0.30% 0.17% 18.15% NA
Indica II  465 58.70% 11.40% 0.43% 29.46% NA
Indica III  913 58.20% 4.50% 0.66% 36.69% NA
Indica Intermediate  786 69.20% 6.70% 0.89% 23.16% NA
Temperate Japonica  767 96.20% 3.30% 0.00% 0.52% NA
Tropical Japonica  504 48.80% 50.60% 0.20% 0.40% NA
Japonica Intermediate  241 78.80% 20.30% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 87.50% 1.04% 8.33% NA
Intermediate  90 71.10% 24.40% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1214629307 C -> DEL N N silent_mutation Average:69.073; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg1214629307 C -> T LOC_Os12g25360.1 upstream_gene_variant ; 2938.0bp to feature; MODIFIER silent_mutation Average:69.073; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N
vg1214629307 C -> T LOC_Os12g25350.1 intron_variant ; MODIFIER silent_mutation Average:69.073; most accessible tissue: Zhenshan97 young leaf, score: 85.184 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1214629307 NA 3.74E-13 mr1016 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.20E-10 mr1017 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.63E-14 mr1022 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 8.51E-10 mr1023 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 6.05E-12 mr1055 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 2.19E-09 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 6.56E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.99E-13 mr1079 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 2.37E-07 mr1093 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 7.61E-11 mr1132 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.49E-11 mr1142 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.27E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.47E-15 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 2.97E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.69E-12 mr1390 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 4.80E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.61E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 5.64E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.89E-12 mr1490 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 7.83E-06 7.83E-06 mr1499 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.15E-09 mr1546 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.23E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 2.50E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.91E-07 mr1805 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 1.40E-06 9.77E-07 mr1825 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.49E-15 mr1022_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 4.68E-11 mr1023_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 6.21E-13 mr1055_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 2.73E-15 mr1079_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.58E-12 mr1132_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 4.67E-15 mr1178_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 1.22E-15 mr1390_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.89E-15 mr1490_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 8.18E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 3.28E-07 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1214629307 NA 5.74E-06 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251